Home Identification of GNB1 as a downstream effector of the circRNA-0133711/miR-145-5p axis involved in breast cancer proliferation and metastasis
Article Open Access

Identification of GNB1 as a downstream effector of the circRNA-0133711/miR-145-5p axis involved in breast cancer proliferation and metastasis

  • Huimei Zou ORCID logo , Peilei Chen ORCID logo , Zhongkui Li , Tingliang Yan , Daolin Cui , Lei Gong , Jie Fang , Yu Ren , Min Chen , Jie Yu , Jun Yu , Juan Luo EMAIL logo and Fan Zhang ORCID logo EMAIL logo
Published/Copyright: June 18, 2024
Download Article (PDF)
Oncologie
From the journal Oncologie Volume 26 Issue 5

Abstract

Objectives

Despite the involvement of the G protein beta-1 (GNB1) protein in various cancer types, its relationship to breast tumours is presently uncertain. This research focused on the expression of GNB1 in breast cancer and its possible biological ramifications in an effort to explain this confusion.

Methods

The expression levels of GNB1 in adjacent normal tissues and breast cancer were compared. We next constructed GNB1-overexpressed or -knockdown MDA-MB-231 cell lines in order to clarify GNB1’s function in breast cancer. We used colony-formation assays, CCK-8 assays, xenograft models, and transwell migration/invasion assays to evaluate the effect of GNB1 on tumorigenicity, migration, and invasion. Moreover, we used western blot analysis to investigate the significance of FAK/mTOR signalling in GNB1-regulated tumour stimulatory effects in breast cancer. Finally, we investigated the upstream regulatory signaling of GNB1 using luciferase reporter and functional repair assays.

Results

When comparing human breast cancer specimens to specimens of normal tissue, we discovered that GNB1 was noticeably overexpressed. This phenotype was also found to be substantially associated with unfavourable clinical outcomes. Functional research findings indicate that elevated expression of GNB1 stimulated the proliferation and metastasis of breast cancer cells. Additionally, we discovered that GNB1 activated the FAK/mTOR signalling cascade by directly inducing the phosphorylation of the FAK protein through specific contacts. According to the results of the RNA pull-down assays and dual-luciferase reporter, we concluded that circRNA-0133711 functions as a competitive endogenous RNA (ceRNA) that sequesters miR-145-5p and thereby relieves its repressive effect on GNB1 expression.

Conclusions

Collectively, our research findings elucidate the hitherto unexplored important role of the circRNA-0133711/miR-145-5p/GNB1 axis in the formation of breast cancer, and provide a new biomarker for clinical diagnosis and treatment of breast cancer.

Keywords: breast cancer; proliferation; metastasis; g protein beta-1; circular RNA

Introduction

Breast cancer remains a leading cause of cancer-related mortality among women worldwide [1]. Each year, there is a significant number of new breast cancer cases and related deaths, and breast cancer constitutes an ever-increasing proportion of all cancer diagnoses [2, 3]. The essential features of cancer include evasion of growth suppression mechanisms, resistance to apoptosis, unrestricted replication potential, angiogenesis, and an inclination toward invasive metastasis [4]. The main causes of breast cancer-related deaths are uncontrolled cell growth and metastasis, which is difficult to detect [5]. Therefore, understanding the molecular mechanisms underlying cellular growth and metastasis in breast cancer is critical for developing effective preventative and therapeutic measures.

Guanine nucleotide-binding protein (G protein)-coupled receptors (GPCRs) are a class of transmembrane proteins that are adept at recognizing various extracellular signaling entities, such as hormones and neurotransmitters, thereby initiating intracellular signaling cascades [6]. G protein beta-1 (GNB1) serves as an important factor that binds and activates GPCRs upon ligand-induced stimulation, coordinating downstream signaling pathways that modulate cellular survival, proliferation, and motility [7]. As a key component of the G protein complex, GNB1 facilitates the transduction of external signals from the cellular periphery to the nucleus [8]. The symbiotic interplay between GNB1 and GPCRs underlies numerous cellular phenomena [9]. Recent studies highlight that aberrations in GNB1, particularly mutations, emerge in specific malignancies, leading to aberrant activation of signaling pathways and contributing to uncontrolled cellular expansion and proliferation. Patients with significant overexpression of GNB1 in cervical squamous cell carcinoma tend to have a poorer prognosis [10]. Furthermore, GNB1 has been associated with the acceleration of hepatocellular carcinoma progression through the P38/MAPK signaling pathway, targeting BAG2 [11]. While elevated transcript levels of GNB1 in breast cancer specimens have been confirmed, their precise mechanistic role in breast cancer development remains incompletely understood.

Circular RNAs (circRNAs), a type of noncoding RNA, primarily originate from intronic, exonic, or intergenic regions [12]. circRNAs were historically regarded as inconsequential splicing anomalies lacking substantive biological implications [13], but their significance has been increasingly recognized with advancements in biotechnology. These integrated methods have revealed the pivotal role of circRNAs in orchestrating cellular differentiation, maintaining tissue homeostasis, and contributing to disease pathogenesis [14]. Research on circRNAs entered a new era following the 2013 discovery of their ability to act as molecular sponges for miR-7 [15]. These circular entities intricately modulate gene expression by binding to microRNAs (miRNAs) to influence a myriad of physiological processes [16]. Liu et al. proved that hsa_circ_001783 enhances breast cancer cell dynamics by sequestering miR-200c-3p [17]. Similarly, Sang et al. demonstrated that circRNA_0025202 influences the progression of breast cancer by adsorbing and inhibiting miR-182-5p [18]. Additionally, the inherent looped configuration of circRNAs provides protection from nuclease-mediated degradation, which is reflected by the increased stability of circRNAs compared to linear RNA counterparts [19]. Notably, high-throughput sequencing analysis previously revealed the significant upregulation of circRNA-0133711 in breast cancer specimens [20], but the molecular mechanisms through which it contributes to breast carcinogenesis have not been determined.

Our study revealed increased expression of GNB1 in breast cancer specimens and highlighted its role in driving cellular proliferation and increasing metastatic potential in breast cancer. Interestingly, we found that circRNA-0133711 sequesters miR-145-5p, facilitating GNB1 production and subsequently promoting the FAK/mTOR pathway in breast cancer cells. In summary, the findings of this study may provide a potential avenue for future breast cancer diagnosis and treatment.

Materials and methods

Human tissue specimens

Fresh breast cancer samples were taken from 42 patients diagnosed with breast cancer, of whom seven had triple-negative breast cancer. Normal tissue adjacent to the cancer was also obtained as normal control samples. These samples were collected during surgical interventions for breast cancer at our medical institution, the Affiliated Hospital of Guizhou Medical University. Protocols involving the use of human materials were approved by Guizhou Medical University’s Institutional Ethics Committee (Guiyang, China) (Approval Number: 2021-19). All participants provided informed written consent after receiving comprehensive information about the study. Each tissue sample, with an approximate volume of 0.5 cm³, was quickly preserved at low temperature. Some of the tissues were fixed in formalin and cut into sections for subsequent morphological observation. Pathological evaluations confirmed that these samples were breast cancer tissues.

Cell lines

The MDA-MB-231 cells were purchased from the American Type Culture Collection (ATCC, USA). RPMI 1640 medium (Gibco, USA), supplemented with 10 % fetal bovine serum (Gibco, USA), was used to simulate the in vitro survival environment of these cells. These cells were meticulously maintained under aseptic conditions at 37 °C in an atmosphere comprising 5 % CO2 and subcultured using standard techniques when they reached approximately 80 % confluence. Manipulation of GNB1 expression was achieved through the use of the pEZ-Lv201 vector, while attenuation of the GNB1 gene was achieved using the pGLV3/shGNB1 vector. Both procedures leveraged the effectiveness of the lentiviral expression system. The miR-145-5p mimic was procured from RiboBio in China, while the pLCDH-ciR plasmid harboring circRNA-0133711 was obtained from GeneSeed in China. Both were transfected into cells using liposome-mediated transfection. The sequences of shRNA and miRNA mimic are listed in Table 1.

Table 1:

shRNA sequences or miRNA mimic.

Primer name Sequence (5′ to 3′)
shRNA targets GNB1 CGAGCAACTTAAGAACCAGAT
shRNA 1#
GNB1 GCTTGTGATGCTTCAGCCAAA
shRNA 2#
MiR-145-5p mimic Sense GUCCAGUUUUCCCAGGAAUCCCU
Antisense AGGGAUUCCUGGGAAAACUGGAC
NC mimic Sense UCACAACCUCCUAGAAAGAGUAGA
Antisense UCUACUCUUUCUAGGAGGUUGUGA

Quantitative real-time PCR (RT-qPCR)

TRIzol (Takara, Japan) can rapidly lyse cells and inhibit nucleases released by cells while preserving the integrity of RNA, therefore, it was also used for RNA extraction in this study. Total RNA was diluted to the desired concentration with diethyl pyrocarbonate (DEPC)-treated water. For quantitative analysis, all RNAs were reverse transcribed into cDNA. RT-qPCR, as the most classical method for quantitative analysis of genes, was also employed for the detection of related genes in this study. The reverse transcription kit and the SYBR Green qPCR Master Mix kit were both purchased from Takara (Takara Bio Inc., Japan). Data analysis was conducted using the 2−ΔΔCt method. The PCR primers used are listed in Table 2.

Table 2:

PCR primer sequences.

Primer Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′)
GNB1 TCACAAACAACATCGACCCAG CGAGGCACTGACGAG AAGC
GAPDH TGTGGGCATCAATGGATTTGG ACACCATGTATTCCGGGTCAAT
hsa_circ_0133711 AGGACAGAACCTTGGACCACA TAGGATCTGTAATTGCATCAA
ACTB AGCGAGCATCCCCCAAAGTT GGGCACGAAGGCTCATCATT
U6 GCTTCGGCAGCACATATACT GGTGCAGGGTCCGAGGTAT
miR-145-5p GGATTCCTGGAAATACTGTTCT TGGAACGCTTCACGAATTTGCG

Western blotting (WB)

Proteins were extracted using a lysis solution. The obtained supernatant was collected, and the subsequent steps involved its quantification and denaturation. The samples were separated on a 10 % SDS-PAGE gel and then cut according to the molecular weight of the marker. Subsequently, for protein analysis, the samples were electrotransferred onto PVDF membranes (Roche, USA). 5 % BSA was used to block PVDF membranes to minimize nonspecific reactions. After incubation with primary antibodies and appropriate secondary antibodies, the membranes were washed to remove unbound antibodies for visualization. Visualization of the protein bands was achieved following incubation with a horseradish peroxidase (HRP) chemiluminescence solution from Millipore, USA. The manufacturer and article numbers for the antibodies are provided in Table 3.

Table 3:

Antibodies.

Names Manufacturer Cat. No.
Anti-GNB1 Abcam, UK ab137635
Anti-FAK Abcam, UK ab40794
Anti-phospho-FAK Abcam, UK ab81298
Anti-mTOR Abcam, UK ab134903
Anti-phospho-mTOR Abcam, UK ab137133
Tubulin Abcam, UK ab6160
GAPDH Abcam, UK ab8245

Transwell

Medium containing 10 % fetal bovine serum was introduced into the subventricular cavity. Additionally, 200 μL of a serum-free cell suspension with a cell density of 1×105/mL was added to the upper compartment. To simulate cell migration under normal physiological conditions, the cells were incubated in an incubator for 24 h. The incubation conditions were the same as those described above for cell culture. Following incubation, the cells on the lower side were then fixed with 4 % paraformaldehyde for 15 min. After fixation, the cells were stained with a crystal violet solution for 20 min, washed with 1× Phosphate Buffered Saline (PBS) with a pH of 7.4, and air-dried at room temperature. In the invasion experiment, we will apply a layer of Matrigel to the bottom of the upper chamber, while all other steps will remain consistent with the migration experiment. Microscopic analysis(BX53F2, OLYPUMS, Japan) was conducted, and images of five randomly selected fields were captured. Using ImageJ version 2 software, the number of cells that migrated through the membrane was determined, and the mean value was used for subsequent statistical analyses.

Cell Counting Kit-8 (CCK-8) assays

The 96-well plate was inoculated with 100 cells per well. After the indicated incubation duration, 10 μL CCK-8 solution reagent (Biosharp, China) was added to each well. Continue incubating for 1–4 h to ensure complete reaction of the reagent with the cells. Afterward, the absorbance of the 96-well plate was measured using a microplate reader (model 51119200, Thermo Fisher Scientific, America) with a wavelength set at 450 nm. The absorbance values indicate cell viability differences between groups. To ensure precision and reproducibility, all experiments were iterated in triplicate.

Colony formation assay

Following transfection, 1,000 cells in all were planted into six-well plates and grown in RPMI 1640 medium. The cell culture plates are incubated under sterile conditions at 37 °C in a 5 % CO2 atmosphere to facilitate cell adhesion and proliferation. Throughout the incubation period, the culture medium is regularly replaced to ensure optimal growth conditions. After two weeks, employed 4 % formaldehyde fixing for 10 min, then 1 % crystal violet staining was applied to the cells for 30 min. The colony numbers were calculated using Image J software.

Analysis of cell apoptosis

MDA-MB-231 cells (1×105/well) were transduced with lentivirus and controls to establish models with either GNB1 knockdown (LV shGNB1) or control models. After 48 h of cultivation, cells were incubated with 10 µL of Propidium Iodide (PI) and Annexin V-FITC for 30 min. This combination allows differentiation between early apoptotic, late apoptotic, and dead cells. Subsequently, samples were analyzed using flow cytometry (Novocyte 3080, Ansenbio, America).

Immunofluorescence analysis

Initially, cells were fixed and permeabilized with an appropriate detergent to increase antibody penetration. Next, specific primary antibodies (GNB1; 1:200) designed to bind to the target proteins were applied, and the samples were treated overnight. The pivotal subsequent step involved the addition of secondary antibodies (1:200) with fluorescent tags, which bind the primary antibodies. Following another round of washing to remove unbound secondary antibodies, the sample was prepared for observation under a fluorescence microscope (1X71, Olympus, Japan). Detection of the emitted fluorescence facilitates accurate determination of the location of the target protein within the cellular environment.

Co-immunoprecipitation

Proteins were isolated from MDA-MB-231 cells using lysis buffer. Then, the cell extracts were incubated with IgG and Protein A/G-agarose at 4 °C for 2 h. After being added to the GNB1- or FAK-specific antibodies, the protein extracts were incubated overnight at 4 °C. Subsequently, the mixture was centrifuged to collect Protein A/G-agarose. For protein extraction, Laemmli buffer was utilized. The immunoprecipitated proteins were then transferred to PVDF membranes. Diluted antibodies against GNB1 and FAK were applied. The subsequent procedure was identical to standard Western blotting protocols. Specific information on the antibodies is listed in Table 3.

RNA pull-down assay

To produce probe-coated beads, the biotinylated-circ-0133711 probe was treated with C-1 magnetic beads (Thermo Fisher Scientific, USA). After that, it was incubated with MDA-MB-231 cells for an overnight period at 4 °C to extract miRNAs linked to circ-0133711-associated cells. After rinsing the C1 beads, the pull-down complex was eluted, and subsequently, RNA was isolated from this eluted complex for further RT-qPCR analysis. The probe sequences are listed in Table 4.

Table 4:

Probe sequences.

Probes Primer name Sequence (5′ to 3′)
Probes for FISH hsa_circ_0133711 GTTACCACCTGGCCCATAAAAGGG
Probes for RNA pull-down hsa_circ_0133711 TACCACCTGGCCCATAAAAG
Scramble negative control CAACTCGATTATCATTGCAT

RNA fluorescence in situ hybridization (RNA FISH)

Tissue sections were first prepared and incubated with RNA probes specific to the target circRNA_0133711 in a hybridization buffer for 12 h to ensure optimal probe-target interaction. Subsequently, the labeled Cyanine 3 (Cy3) probe was applied to the sections, allowing for specific hybridization. The sections were then washed to remove unbound probes and mounted for microscopy (1X71, Olympus, Japan). Under a fluorescence microscope (1X71, Olympus, Japan), the circRNA_0133711 expression patterns were visualized, providing crucial insights into its subcellular localization and expression levels. The probe sequences are listed in Table 4.

Dual-luciferase reporter assay

A 24-well plate was used for incubating the cells. HEK293 cells were chosen for this study due to their low endogenous gene expression. The cell density was adjusted to 1×105 cells/well and cultured. The miR-145-5p mimic was cotransfected into the cells alongside the pmirGLO-circRNA_0133711 plasmid (GeneSeed, China), and a corresponding control group was also established. In this study, the pRL-TK plasmid (Promega, USA) served as the control luciferase and was co-transfected into HEK293 cells with the other plasmids. After 48 h of culture, the cells were lysed, and the lysate was then collected. The Dual Luciferase Reporter Assay Kit (Promega, USA) was employed to measure their luciferase activity, following the established protocols.

Xenograft tumor model

Due to thymic deficiency, which inhibits T lymphocyte development, nude mice exhibit an environment conducive to unrestricted growth and dissemination of tumor cells within their bodies. Consequently, nude mice are commonly used in tumor research for in vivo testing. In this study, 12 female 4- to 5-week-old nude mice were acquired from the Animal Experimental Center of Guizhou Medical University. The present study was conducted with the endorsement of the Institutional Animal Ethics Committee of Guizhou Medical University (Approval Number: 2100451). MDA-MB-231 cells were subsequently subcutaneously injected into the dorsal region of the mice, and the progression of tumor growth was systematically monitored on a weekly basis. After a 30-day period, the mice were humanely euthanized to allow for the collection and analysis of tumor specimens. The study was strictly adhered to guidelines aimed at minimizing animal pain and distress.

Analysis of biological information database

A range of miRNAs were identified as candidates with putative binding sites on GNB1 mRNA via the TargetScan database (https://www.targetscan.org/vert_80/). Simultaneously, select miRNAs were predicted to directly interact with hsa_circ_0133711 via the CircInteractome Database (https://circinteractome.irp.nia.nih.gov/index.html).

Statistical analysis

The chi-square test was employed to assess direct associations between GNB1 mRNA expression and various clinicopathological parameters, including tumor size, lymphatic spread, TNM grade, and Ki67 expression, in patients diagnosed with breast malignancies. For the comparison of means between two groups, a t-test was employed, while an analysis of variance (ANOVA) was used to compare the means across multiple groups. The relationship between circ-0133711 and miR-145-5p expression in tissues was analyzed via Spearman correlation coefficient analysis. Data from at least three replicates are presented as the mean±standard deviation (mean±SD). GraphPad Prism 8.0 software (GraphPad Software, USA) was used for the statistical analyses (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

Results

Overexpression of GNB1 in breast cancer is associated with poor patient prognosis

We used RT-qPCR to assess GNB1 mRNA levels in 42 matched samples of breast cancer tissues and the corresponding adjacent normal tissues in order to ascertain the expression profile of GNB1 in breast cancer tissues. The findings showed that the expression of the GNB1 gene was statistically significantly higher in breast cancer specimens than in their normal counterparts (p<0.05; Figure 1A). These findings were further validated through Western blot and immunohistochemistry assays conducted on an independent set of 16 samples (Figure 1B and C). Similarly, patterns in the TCGA oncogenomic database resonate with our observations. Kaplan–Meier survival analysis plots (K–M plots) revealed that elevated GNB1 levels in breast cancer biopsies correlated with decreased patient survival (Figure S1). Various factors, such as age, menstrual cycle, tumor dimensions, lymphatic invasion, TNM categorization, and differentiation grade significantly influence the initiation, progression, and outcome of breast cancer. Correlation analysis revealed direct associations between GNB1 mRNA expression and tumor size, lymphatic spread, TNM grade, and Ki67 expression in patients with breast malignancies. Conversely, an inverse relationship was observed with tumor differentiation grade (p<0.05). Notably, GNB1 expression exhibited no apparent association with other clinical markers, such as menopausal stage, age, ER, PR, or HER-2 expression (p>0.05; Table 5). These findings emphasize the notable upregulation of GNB1 in breast carcinoma tissues. Furthermore, its overexpression is correlated with a poor patient prognosis, but interestingly, no substantial correlation was found between GNB1 expression and the characteristic features of triple-negative breast cancer.

Figure 1: GNB1 expression in breast cancer and adjacent normal tissues. (A) The GNB1 mRNA levels in 42 pairs of breast cancer tissues were tested. (B) The GNB1 protein levels in 16 pairs of breast cancer tissues were tested. (C) Images of the immunohistochemical staining results demonstrate the expression of the GNB1 protein in breast tissues. Data from at least three replicates are presented as the mean±SD (***p<0.001).
Figure 1:

GNB1 expression in breast cancer and adjacent normal tissues. (A) The GNB1 mRNA levels in 42 pairs of breast cancer tissues were tested. (B) The GNB1 protein levels in 16 pairs of breast cancer tissues were tested. (C) Images of the immunohistochemical staining results demonstrate the expression of the GNB1 protein in breast tissues. Data from at least three replicates are presented as the mean±SD (***p<0.001).

Table 5:

Relationship between the expression of GNB1 and clinicopathological features in breast cancer.

Clinicopathological variables Total (n=42) High expression (n=21) Low expression (n=21) χ2 p-Value
Age
 ≤55 years 17 9 8 0.099 0.753
 >55 years 25 12 13
Menstruation situation
 Postmenopause 22 10 12 0.382 0.537
 Premenopause 20 11 9
Tumor size
 ≤2 cm3 14 3 11 6.857 0.009
 >2 cm3 28 18 10
Lymph node metastasis
 No 23 7 16 7.785 0.005
 Yes 19 14 5
TNM classification
 I–II 27 7 20 17.526 <0.001
 III–IV 15 14 1
Differentiation
 Well 5 0 5 10.693 0.005
 Moderate 25 11 14
 Poor 12 10 2
HER-2
 Positive 17 9 8 0.099 0.753
 Negative 25 12 13
PR
 Positive 23 10 13 0.865 0.352
 Negative 19 11 8
ER
 Positive 27 14 13 0.104 0.445
 Negative 15 7 8
Index of Ki67
 ≤14 % 29 11 18 5.549 0.019
 >14 % 13 10 3

  1. HER2, Human Epidermal Growth Factor Receptor; PR, Progesterone Receptor; ER, Estrogen Receptor.

GNB1 notably influences the proliferation and metastasis of breast cancer cells

Unrestrained proliferation and distant dissemination represent the defining characteristics of malignant cell behavior. To elucidate the impact of GNB1 on the dynamics of breast cancer cells, particularly in terms of proliferation and metastasis, MDA-MB-231 cells were transduced with lentivirus or their respective controls to establish models with either GNB1 knockdown (LV shGNB1) or GNB1 overexpression (LV-GNB1) and control models. The effectiveness of the transfection method was verified through detailed quantitative assessments of RT-qPCR and WB results (p<0.05; Figure 2A and B). Using Transwell assays to assess the influence of GNB1 on breast cancer cell migration, and we detected a significant reduction in cellular migration in the LV-shGNB1 group compared to the LV-shNC group. Conversely, compared with cells in the LV-empty cohort, the cells in the LV-GNB1 group exhibited a marked increase in migration ability (Figure 2C). In addition, to verify the invasion ability of the cells, we applied a layer of Matrigel to the bottom of the upper chamber. The results obtained from this experiment exhibited a trend that was consistent with our migration experiment, further supporting our findings on the migratory and invasive capabilities of the cells. We believe that this additional layer of validation strengthens the reliability and validity of our study (Figure 2D). Investigation of cellular proliferation through formation plate colony formation and CCK-8 assays revealed that robust GNB1 suppression markedly suppressed MDA-MB-231 cell proliferation, while forced overexpression clearly promoted proliferation (Figure 3A and B). Additionally, flow cytometry revealed that knocking down the expression of GNB1 significantly increases the rate of apoptosis in cells (p<0.05; Figure 3C). In vivo, in a subcutaneous xenograft model, GNB1 was found to play a pivotal role by significantly increasing tumor mass and volume (Figure 3D). Overall, these findings highlight the instrumental role of GNB1 in stimulating both the proliferation and migration of breast cancer cells.

Figure 2: The migratory capacity of breast cancer cells was assessed through transwell assays. (A) The expression levels of GNB1 in each group of cells were assessed using RT-qPCR. (B) Quantitative analysis of GNB1 protein expression in each group of cells. (C) Transwell assays were conducted to assess the migratory capacity of the cells. (D) Transwell assays were conducted to assess the invasion capacity of the cells. Data from at least three replicates are presented as the mean±SD (*p<0.05, **p<0.01, ***p<0.001).
Figure 2:

The migratory capacity of breast cancer cells was assessed through transwell assays. (A) The expression levels of GNB1 in each group of cells were assessed using RT-qPCR. (B) Quantitative analysis of GNB1 protein expression in each group of cells. (C) Transwell assays were conducted to assess the migratory capacity of the cells. (D) Transwell assays were conducted to assess the invasion capacity of the cells. Data from at least three replicates are presented as the mean±SD (*p<0.05, **p<0.01, ***p<0.001).

Figure 3: The proliferative capacity of breast cancer cells was assessed. (A) The CCK-8 assay was used to determine cell viability at various time points. (B) A colony formation assay was conducted to evaluate the proliferative capacity of the cells. (C) Annexin V and propidium iodide staining were utilized to detect the apoptosis rate. (D) Stabilized transfected cells were inoculated into nude mice, and at 30 days postinoculation, the xenograft tumors were harvested. Data from at least three replicates are presented as the mean±SD (*p<0.05, **p<0.01, ***p<0.001).
Figure 3:

The proliferative capacity of breast cancer cells was assessed. (A) The CCK-8 assay was used to determine cell viability at various time points. (B) A colony formation assay was conducted to evaluate the proliferative capacity of the cells. (C) Annexin V and propidium iodide staining were utilized to detect the apoptosis rate. (D) Stabilized transfected cells were inoculated into nude mice, and at 30 days postinoculation, the xenograft tumors were harvested. Data from at least three replicates are presented as the mean±SD (*p<0.05, **p<0.01, ***p<0.001).

GNB1 induces activation of the FAK/mTOR pathway by directly interacting with the FAK protein

Focal adhesion kinase (FAK) and mammalian target of rapamycin (mTOR) play crucial roles as signaling proteins, influencing cellular metabolism, proliferation, and expansion [21]. Numerous studies emphasize the significance of the FAK/mTOR signaling axis in the genesis and progression of cancer [22, 23]. The promotion of FAK phosphorylation through intricate protein interactions is recognized as a key mechanism that enhances the FAK/mTOR signaling cascade. In our study, through the utilization of cellular immunofluorescence, we have unequivocally demonstrated the spatial co-localization of GNB1 and FAK. Furthermore, reciprocal coimmunoprecipitation assays have confirmed the existence of a direct association between GNB1 and FAK. These findings provide strong evidence for the interaction between these two proteins and contribute significantly to our understanding of their role in the cellular processes under investigation (Figure 4A and B). Notably, inhibiting GNB1 resulted in a noticeable reduction in the levels of activation markers of FAK/mTOR signaling. Conversely, overexpression of GNB1 significantly enhanced the phosphorylation of FAK and mTOR. However, the introduction of PF-573228, a crucial antagonist of FAK phosphorylation, effectively abolished the activation of the FAK/mTOR signaling pathway induced by GNB1 (Figure 4C and D). These findings provide substantial evidence supporting the hypothesis that GNB1 catalyzes the activation of the FAK/mTOR axis primarily through direct interaction with the FAK protein in breast cancer cells.

Figure 4: Verification of the effects of GNB1 on the FAK/mTOR pathway in breast cancer cells (A) immunofluorescence costaining images of FAK and GNB1 in MDA-MB-231 cells are presented. The colors indicate expression or staining as follows: FAK, red; GNB1, green; and DAPI, blue. The colocalization of FAK and GNB1 is shown in yellow. (B) A coimmunoprecipitation assay was conducted to verify the interaction between GNB1 and FAK. (C and D) The levels of total and phosphorylated FAK and mTOR were analyzed.
Figure 4:

Verification of the effects of GNB1 on the FAK/mTOR pathway in breast cancer cells (A) immunofluorescence costaining images of FAK and GNB1 in MDA-MB-231 cells are presented. The colors indicate expression or staining as follows: FAK, red; GNB1, green; and DAPI, blue. The colocalization of FAK and GNB1 is shown in yellow. (B) A coimmunoprecipitation assay was conducted to verify the interaction between GNB1 and FAK. (C and D) The levels of total and phosphorylated FAK and mTOR were analyzed.

GNB1 is regulated by the circRNA-0133711/miR-145-5p axis in the context of breast cancer cells

In a previous high-throughput sequencing study, hsa_circ_0133711 was identified as significantly upregulated in malignant breast tissues vs. normal tissues and was found to be strongly correlated with GNB1 mRNA levels [20]. To confirm the expression profile of hsa_circ_0133711 in breast cancer tissues, a fluorescent probe specific for hsa_circ_0133711 was developed. FISH analyses revealed a significant upregulation in the expression of hsa_circ_0133711 in breast cancer tissues (Figure 5A). In addition, RT-qPCR evaluations of 42 paired breast cancer and adjacent tissue samples showed a marked increase in hsa_circ_0133711 expression in the cancer specimens vs. normal specimens (Figure 5B and C). Interestingly, the expression of these genes was directly correlated with the GNB1 mRNA concentration (Figure 5D and E). Competitive endogenous RNA (ceRNA) primarily functions in the cytoplasm. Nuclear/cytoplasmic separation assays revealed that hsa_circ_0133711 is primarily localized in the cytoplasm of cells, thereby substantiating its role as a ceRNA (Figure 5F).

Figure 5: Verification of the correlation between hsa_circ_0133711 and GNB1 expression in the breast tissue of patients (A) RNA FISH was employed to determine the presence of hsa_circ_0133711 in patient breast tissue slices. (B and C) The level of hsa_circ_0133711 was validated via RT-PCR in samples from breast tissues. (D and E) The association between circ-0133711 and miR-145-5p expression in tissues was assessed using Spearman correlation analysis, which revealed a statistically significant correlation (p<0.05, r=0.6444). (F) The nuclear/cytoplasmic separation assays were conducted to determine the precise localization of hsa_circ_0133711 within the cell. Data from at least three replicates are presented as the mean±SD (****p<0.0001).
Figure 5:

Verification of the correlation between hsa_circ_0133711 and GNB1 expression in the breast tissue of patients (A) RNA FISH was employed to determine the presence of hsa_circ_0133711 in patient breast tissue slices. (B and C) The level of hsa_circ_0133711 was validated via RT-PCR in samples from breast tissues. (D and E) The association between circ-0133711 and miR-145-5p expression in tissues was assessed using Spearman correlation analysis, which revealed a statistically significant correlation (p<0.05, r=0.6444). (F) The nuclear/cytoplasmic separation assays were conducted to determine the precise localization of hsa_circ_0133711 within the cell. Data from at least three replicates are presented as the mean±SD (****p<0.0001).

Further analyses demonstrated that external amplification of hsa_circ_0133711 significantly enhanced (p<0.0001) GNB1 expression within the MDA-MB-231 cellular environment (Figure 6B and C). Considering the predominant functions of circRNAs as miRNA decoys and gene orchestrators, we proposed a potential miRNA-mediated regulatory axis through which hsa_circ_0133711 modulates GNB1 expression. A range of miRNAs were identified as candidates with putative binding sites on GNB1 mRNA via the TargetScan database. Simultaneously, select miRNAs were predicted to directly interact with hsa_circ_0133711 via the CircInteractome Database. Notably, miR-145-5p was the only miRNA predicted via both databases and was thus selected as the focus of our study (Figure 6A). Our observations revealed that hsa_circ_0133711 overexpression not only led to a significant decrease in miR-145-5p expression in MDA-MB-231 cells but also induced a noticeable increase (p<0.0001) in GNB1 mRNA concentration, which leads to activation of the FAK/mTOR signaling cascade (Figure 6B and C and Figure S2). Treatment of these cells with miR-145-5p mimics mitigated the effects induced by hsa_circ_0133711 overexpression.

Figure 6: GNB1 is regulated by the circRNA-0133711/miR-145-5p axis. (A) The miRNAs potentially binding to GNB1 are illustrated in the red region, while those potentially binding to hsa_circ-0133711 are depicted in the blue region. The green region represents the overlap between the two sets of miRNAs. (B and C) Hsa_circ_0133711 was overexpressed in MDA-MB-231 cells through transfection with either mic-NC or mic-miR-145-5p. The detection of related genes and proteins was conducted using RT-qPCR and Western blot analysis. (D) A circRNA_0133711-specific probe was used to extract circRNA_0133711 and miR-145-5p from MDA-MB-231 cells, and their levels were measured using RT-qPCR. (E and F) Dual-luciferase reporter experiments were carried out to confirm the interactions between circRNA-0133711 and miR-145-5p, as well as between GNB1 and miR-145-5p. Data from at least three replicates are presented as the mean±SD (NS, p>0.05, **p<0.01, ***p<0.001, ****p<0.0001).
Figure 6:

GNB1 is regulated by the circRNA-0133711/miR-145-5p axis. (A) The miRNAs potentially binding to GNB1 are illustrated in the red region, while those potentially binding to hsa_circ-0133711 are depicted in the blue region. The green region represents the overlap between the two sets of miRNAs. (B and C) Hsa_circ_0133711 was overexpressed in MDA-MB-231 cells through transfection with either mic-NC or mic-miR-145-5p. The detection of related genes and proteins was conducted using RT-qPCR and Western blot analysis. (D) A circRNA_0133711-specific probe was used to extract circRNA_0133711 and miR-145-5p from MDA-MB-231 cells, and their levels were measured using RT-qPCR. (E and F) Dual-luciferase reporter experiments were carried out to confirm the interactions between circRNA-0133711 and miR-145-5p, as well as between GNB1 and miR-145-5p. Data from at least three replicates are presented as the mean±SD (NS, p>0.05, **p<0.01, ***p<0.001, ****p<0.0001).

A probe specifically designed to bind hsa_circ_0133711 was generated. The results revealed pronounced coenrichment of hsa_circ_0133711 and miR-145-5p on the hsa_circ_0133711 probe (Figure 6D), suggesting that miR-145-5p is likely sequestered by hsa_circ_0133711. Additionally, dual-luciferase reporter constructs were carefully designed to encompass potential binding sites between miR-145-5p and hsa_circ_0133711. Upon simultaneous transfection of human embryonic kidney 293 (HEK293) cells with either miR-145-5p or negative control (NC) mimics, a conspicuous reduction in luciferase activity was observed in the presence of miR-145-5p mimics, specifically for the pmirGLO-circ_0133711 construct. This effect was not observed for the NC constructs (Figure 6E). A subsequent luciferase assay further confirmed the strong interaction between miR-145-5p and GNB1, as evidenced by the noticeable decrease in luciferase activity of the designated reporter induced by the miR-145-5p mimics (Figure 6F). These collective findings affirm the role of circ_0133711 as a miR-145-5p decoy: miR-145-5p directly interacts with the 3′UTR domain of GNB1 mRNA.

Discussion

The etiology of breast cancer is multifaceted and involves factors such as genetics, hormones, and immunity; however, its pathogenesis mechanism has not been fully elucidated [24]. Although the characteristics of malignant tumors are complex, unrestrained proliferation and heightened metastatic potential are particularly salient features of tumor cells, including breast cancer cells [25, 26]. While early detection of breast cancer results in promising therapeutic outcomes, the initial symptoms are often subtle, and highly specific and sensitive screening methods are lacking. Consequently, many patients are diagnosed in advanced stages, at which point the risk of metastasis is higher. Metastasis is a significant event that is often incurable and contributes to high mortality rates [27], [28], [29]. In recent years, considerable advancements have been achieved in the basic research of breast cancer, leading to an enhanced understanding of associated genes and molecular mechanisms. In recent studies, several molecules involved in promoting tumor cell proliferation and invasion have been identified as novel therapeutic targets. Some of these molecules were also found to have potential as prognostic markers for breast cancer patients [30]. Despite these achievements, there is an urgent need to explore the pivotal drivers that endow tumors with unrestrained proliferative capacity and metastatic traits. A continued effort to further elucidate the molecular mechanisms is crucial for expanding the body of knowledge and facilitating the development of more effective strategies for diagnosis, treatment, and prognosis evaluation.

G proteins and G protein-coupled receptors (GPCRs) are vital for mediating cellular signal transduction and coordinating various physiological processes [31]. GPCRs, which are transmembrane proteins, function as receptors for a variety of extracellular stimuli, including hormones and neurotransmitters [32]. Upon binding to ligands, GPCRs undergo structural alterations that activate associated G proteins. G proteins function as molecular switches within the intracellular signaling cascade [33]. Upon activation, the GPCR facilitates the exchange of GDP for GTP on the G proteins, thereby modulating downstream effectors such as adenylyl cyclase and ion channels, ultimately influencing cellular responses [34, 35]. A thorough grasp of the complex interactions between G proteins and GPCRs is imperative for advancing drug development and deciphering the intricacies of cellular communication.

Guanine nucleotide-binding protein beta-1 (GNB1), a member of the G protein beta family, plays a crucial role in the activation of GTPases, functioning as a modulator or sensor of diverse transmembrane signal transduction pathways [36]. Recent research has increasingly emphasized the pivotal involvement of GNB1 in various malignancies, notably in breast cancer. For example, elevated GNB1 levels have been detected in colorectal tumors and cell lines vs. normal controls [37]. Chen et al. elucidated that patients diagnosed with clear cell renal cell carcinoma exhibit a poorer prognosis when they have higher expression levels of GNB1 [38]. Moreover, GNB1 expression is significantly elevated in breast cancer cells induced by phytoestrogens [39]. In addition to its pivotal role in tumor development, GNB1 has garnered increasing support from the literature as a candidate gene implicated in neurodevelopmental diseases. Notably, GNB1 deletions have been observed in individuals with chromosome 1p36 deletion syndrome, potentially contributing to the onset of this disease through the induction of apoptosis and dysplasia in neuronal cells [40]. In our investigation, GNB1 expression was notably elevated in breast cancer tissues. Functional assessments proved that GNB1 significantly enhances the proliferation and metastatic capability of breast cancer cells. Additionally, we observed that GNB1 induces FAK phosphorylation by directly targeting the FAK protein, thereby activating the mTOR pathway. Cumulative evidence underscores the central oncogenic role of GNB1 in the initiation and advancement of breast cancer.

Once deemed mere molecular anomalies or transcriptional byproducts, circRNAs are now increasingly recognized for their cellular abundance and pivotal role in modulating disease trajectories. Due to their closed-loop structure, circRNAs resist digestion by exonucleases, thus demonstrating greater stability compared to linear RNAs. This property positions circRNAs as promising diagnostic markers for diseases [41, 42]. Recently, there has been growing attention on the role of circular RNA in the initiation and progression of malignant tumors [43]. For instance, hsa_circRNA_102002 demonstrates significant promotive efficacy in the metastatic process of papillary thyroid cancer cells [44]. Cui et al. demonstrated that CircHERC1 is significantly upregulated in non-small cell lung cancer tissues and promotes tumor progression [45]. Moreover, Miao et al. revealed that gastric cancer patients with elevated expression levels of Hsa_circ_0136666 in gastric tissue are associated with a worse prognosis [46]. These findings underscore the significant impact of circRNAs on the initiation and progression of various tumors. Notably, GNB1 exhibits deletions, mutations, and aberrant expression under various pathological conditions. These patterns suggest that GNB1 expression in tissues and cells is likely subjected to stringent upstream molecular regulation, but the related mechanisms remain elusive. These findings suggest that GNB1 may be modulated by its upstream circRNA-miRNA signaling axis, further promoting oncogenesis. In our research, hsa_circ_0133711 was markedly overexpressed in human breast cancer tissues. Subsequent comprehensive experiments validated the potential role of the hsa_circ_0133711/miR-145-5p/GNB1 signaling pathway in breast cancer pathogenesis and revealed potential key molecular targets for early breast cancer diagnosis and treatment. Nevertheless, our study has certain limitations. First, the expression of GNB1 in distant metastatic lesions relative to primary tumors requires further validation. Second, the other molecular mechanisms underlying the aberrant expression of GNB1 in breast cancer need further verification. Finally, although we have validated the role of GNB1 in triple-negative breast cancer cells, the role of GNB1 in other types of breast cancer cells remains unclear. We chose to focus our research on MDA-MB-231 cells for two primary reasons. Firstly, we observed that GNB1 expression did not exhibit a clear correlation with the expression of markers such as ER, PR, and HER-2. Additionally, according to our Kaplan–Meier data analysis, higher GNB1 expression appeared to significantly influence the survival duration of patients with triple-negative breast cancer. These considerations influenced our decision to employ this specific cell line in our investigations. Nevertheless, the scientific rationale behind this selection remains debatable and is open for further discussion.

In conclusion, our research characterized GNB1 as a gene intricately associated with oncogenic traits and elucidated its significant correlation with proliferation and metastasis in breast cancer patients, highlighting its diagnostic and prognostic relevance for affected individuals. Mechanistically, we determined that GNB1 triggers the FAK/mTOR pathway through direct interaction with the FAK protein. Additionally, we identified GNB1 as a novel downstream effector in the circRNA-0133711/miR-145-5p network (Figure 7). Consequently, GNB1 is a promising contemporary biomarker for predicting patient prognosis and treatment responsiveness.

Figure 7: To clarify the role of circRNA_0133711 and GNB1 in the progression of breast cancer and their related molecular mechanisms.
Figure 7:

To clarify the role of circRNA_0133711 and GNB1 in the progression of breast cancer and their related molecular mechanisms.

Corresponding authors: Fan Zhang, Department of Pathophysiology, Guizhou Medical University, Guiyang, China; and Key Laboratory of Pathogenesis and Drug Research of Common Chronic Diseases in Guizhou Province, Guizhou Medical University, Guiyang, China, E-mail:; and Juan Luo, Department of Oncology, Qujing Hospital of Traditional Chinese Medicine, Qujing, China, E-mail:
Huimei Zou and Peilei Chen contributed equally to this work.

Funding source: Scientific Research Fund Project of Yunnan Education Department

Award Identifier / Grant number: No. 2023J1760

Funding source: Yunnan Provincial Science and Technology Department-Applied Basic Research Joint Special Funds of Chinese Medicine

Award Identifier / Grant number: 202101AH070157

Funding source: Science and Technology Foundation of Guizhou Provincial Health Commission

Award Identifier / Grant number: gzwkj2023-209

Funding source: National Natural Science Foundation of China’s (NSFC) Cultivation Project, gyfynsfc

Award Identifier / Grant number: [2022]-53

Acknowledgments

We are immensely grateful to all breast cancer patients who participated in this study and generously provided valuable clinical samples. We also extend our sincere appreciation to the nude mice that sacrificed for the purposes of this research. Lastly, we thank the reviewers and editors for their invaluable contributions and diligent efforts in refining this paper.

  1. Research ethics: Protocols involving the use of human materials were approved by Guizhou Medical University’s Institutional Ethics Committee (Guiyang, China) (Approval Number: 2021-19). All patients were recruited from the Affiliated Hospital of Guizhou Medical University (Guiyang, China) and provided written informed consent. The present study was conducted with the endorsement of the Institutional Animal Ethics Committee of Guizhou Medical University (Approval Number: 2100451).

  2. Informed consent: The animal experimentation adhered strictly to the guidelines outlined in the Guide for the Care and Use of Laboratory Animals, published by the US National Institutes of Health. All patients provided written informed consent for this study.

  3. Author contributions: Study design: Huimei Zou and Fan Zhang; sample collection: Juan Luo, Yu Ren and Zhongkui Li; data management and acquisition: Huimei Zou, Peilei Chen, Min Chen, Jie Yu and Jun Yu; data analysis: Tingliang Yan, Lei Gong, Jie Fang and Daolin Cui; draft of the article: Huimei Zou; revision of the article: Fan Zhang.

  4. Competing interests: The authors declare that they have no conflicts of interest.

  5. Research funding: This research received funding from the National Natural Science Foundation of China’s (NSFC) Cultivation Project, gyfynsfc[2022]-53, the Science and Technology Foundation of Guizhou Provincial Health Commission (gzwkj2023-209), the Scientific Research Fund Project of Yunnan Education Department (No. 2023J1760) and the Yunnan Provincial Science and Technology Department-Applied Basic Research Joint Special Funds of Chinese Medicine (202101AH070157).

  6. Data availability: The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

1. Zhao, H, Zhang, XM, Xiao, S, Wu, ZR, Shi, YJ, Xie, MJ. HDAC11 is related to breast cancer prognosis and inhibits invasion and proliferation of breast cancer cells. Int J Clin Exp Pathol 2023;16:172–83.Search in Google Scholar

2. Sung, H, Ferlay, J, Siegel, RL, Laversanne, M, Soerjomataram, I, Jemal, A, et al.. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021;71:209–49. https://doi.org/10.3322/caac.21660.Search in Google Scholar PubMed

3. Wilkinson, L, Gathani, T. Understanding breast cancer as a global health concern. Br J Radiol 2022;95:20211033. https://doi.org/10.1259/bjr.20211033.Search in Google Scholar PubMed PubMed Central

4. Abolhassani, H, Wang, Y, Hammarström, L, Pan-Hammarström, Q. Hallmarks of cancers: primary antibody deficiency versus other inborn errors of immunity. Front Immunol 2021;12:720025. https://doi.org/10.3389/fimmu.2021.720025.Search in Google Scholar PubMed PubMed Central

5. Li, S, Zeng, H, Fan, J, Wang, F, Xu, C, Li, Y, et al.. Glutamine metabolism in breast cancer and possible therapeutic targets. Biochem Pharmacol 2023;210:115464. https://doi.org/10.1016/j.bcp.2023.115464.Search in Google Scholar PubMed

6. Ahn, D, Chung, KY. The conformational dynamics of heterotrimeric G proteins during GPCR-mediated activation. Subcell Biochem 2022;99:271–84. https://doi.org/10.1007/978-3-031-00793-4_8.Search in Google Scholar PubMed

7. Zheng, H, Ma, L, Gui, R, Lin, X, Ke, X, Jian, X, et al.. G protein subunit β1 facilitates influenza A virus replication by promoting the nuclear import of PB2. J Virol 2022;96:e0049422. https://doi.org/10.1128/jvi.00494-22.Search in Google Scholar PubMed PubMed Central

8. Yang, XR, Kassam, F, Innes, AM. Rod-cone dystrophy in an adult with GNB1-related disorder: an expansion of the phenotype and natural history. Am J Med Genet C Semin Med Genet 2023;193:183–7. https://doi.org/10.1002/ajmg.c.32045.Search in Google Scholar PubMed

9. Ruengsinpinya, L, Murakami, T, Nakamura, E, Takahata, Y, Hata, K, Nakaminami, Y, et al.. G protein subunit β1 is an important mediator of the late stage of endochondral ossification. Biochem Biophys Res Commun 2020;533:90–6. https://doi.org/10.1016/j.bbrc.2020.08.119.Search in Google Scholar PubMed

10. Cao, Y, Li, J, Jia, Y, Zhang, R, Shi, H. CircRNA circ_POLA2 promotes cervical squamous cell carcinoma progression via regulating miR-326/GNB1. Front Oncol 2020;10:959. https://doi.org/10.3389/fonc.2020.00959.Search in Google Scholar PubMed PubMed Central

11. Hang, X, Dong, K, Zhang, J, Kuang, T, Luo, Y, Yu, J, et al.. GNB1 promotes hepatocellular carcinoma progression by targeting BAG2 to activate P38/MAPK signaling. Cancer Sci 2023;114:2001–13. https://doi.org/10.1111/cas.15741.Search in Google Scholar PubMed PubMed Central

12. Chen, LL, Bindereif, A, Bozzoni, I, Chang, HY, Matera, AG, Gorospe, M, et al.. A guide to naming eukaryotic circular RNAs. Nat Cell Biol 2023;25:1–5. https://doi.org/10.1038/s41556-022-01066-9.Search in Google Scholar PubMed PubMed Central

13. Huang, A, Zheng, H, Wu, Z, Chen, M, Huang, Y. Circular RNA-protein interactions: functions, mechanisms, and identification. Theranostics 2020;10:3503–17. https://doi.org/10.7150/thno.42174.Search in Google Scholar PubMed PubMed Central

14. Chen, L, Wang, C, Sun, H, Wang, J, Liang, Y, Wang, Y, et al.. The bioinformatics toolbox for circRNA discovery and analysis. Brief Bioinform 2021;22:1706–28. https://doi.org/10.1093/bib/bbaa001.Search in Google Scholar PubMed PubMed Central

15. Memczak, S, Jens, M, Elefsinioti, A, Torti, F, Krueger, J, Rybak, A, et al.. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 2013;495:333–8. https://doi.org/10.1038/nature11928.Search in Google Scholar PubMed

16. He, T, Huang, J, Liang, H, Zhong, B, Xu, G, Zhu, X. Circular RNA hsa_circ_0005239 contributes to hepatocellular carcinoma cell migration, invasion, and angiogenesis by targeting the miR-34a-5p/PD-L1 axis. Cell Biol Int 2023;47:1519–34. https://doi.org/10.1002/cbin.12049.Search in Google Scholar PubMed

17. Liu, Z, Zhou, Y, Liang, G, Ling, Y, Tan, W, Tan, L, et al.. Circular RNA hsa_circ_001783 regulates breast cancer progression via sponging miR-200c-3p. Cell Death Dis 2019;10:55. https://doi.org/10.1038/s41419-018-1287-1.Search in Google Scholar PubMed PubMed Central

18. Sang, Y, Chen, B, Song, X, Li, Y, Liang, Y, Han, D, et al.. circRNA_0025202 regulates tamoxifen sensitivity and tumor progression via regulating the miR-182-5p/FOXO3a axis in breast cancer. Mol Ther 2019;27:1638–52. https://doi.org/10.1016/j.ymthe.2019.05.011.Search in Google Scholar PubMed PubMed Central

19. Amaya, L, Grigoryan, L, Li, Z, Lee, A, Wender, PA, Pulendran, B, et al.. Circular RNA vaccine induces potent T cell responses. Proc Natl Acad Sci U S A 2023;120:e2302191120. https://doi.org/10.1073/pnas.2302191120.Search in Google Scholar PubMed PubMed Central

20. Xu, L, Lyu, M, Yang, S, Zhang, J, Yu, D. CircRNA expression profiles of breast cancer and construction of a circRNA-miRNA-mRNA network. Sci Rep 2022;12:17765. https://doi.org/10.1038/s41598-022-21877-y.Search in Google Scholar PubMed PubMed Central

21. Qi, X, Chen, Y, Liu, S, Liu, L, Yu, Z, Yin, L, et al.. Sanguinarine inhibits melanoma invasion and migration by targeting the FAK/PI3K/AKT/mTOR signalling pathway. Pharm Biol 2023;61:696–709. https://doi.org/10.1080/13880209.2023.2200787.Search in Google Scholar PubMed PubMed Central

22. Demircioglu, F, Wang, J, Candido, J, Costa, ASH, Casado, P, de Luxan Delgado, B, et al.. Cancer associated fibroblast FAK regulates malignant cell metabolism. Nat Commun 2020;11:1290. https://doi.org/10.1038/s41467-020-15104-3.Search in Google Scholar PubMed PubMed Central

23. Lu, H, Hu, H, Li, S. Diagnostic value of beclin-1 and mTOR in ovarian cancer. Int J Clin Exp Pathol 2021;14:238–46.Search in Google Scholar

24. Barzaman, K, Karami, J, Zarei, Z, Hosseinzadeh, A, Kazemi, MH, Moradi-Kalbolandi, S, et al.. Breast cancer: biology, biomarkers, and treatments. Int Immunopharmacol 2020;84:106535. https://doi.org/10.1016/j.intimp.2020.106535.Search in Google Scholar PubMed

25. Hanahan, D, Weinberg, RA. Hallmarks of cancer: the next generation. Cell 2011;144:646–74. https://doi.org/10.1016/j.cell.2011.02.013.Search in Google Scholar PubMed

26. Liang, Y, Zhang, H, Song, X, Yang, Q. Metastatic heterogeneity of breast cancer: molecular mechanism and potential therapeutic targets. Semin Cancer Biol 2020;60:14–27. https://doi.org/10.1016/j.semcancer.2019.08.012.Search in Google Scholar PubMed

27. Wei, Y, Jasbi, P, Shi, X, Turner, C, Hrovat, J, Liu, L, et al.. Early breast cancer detection using untargeted and targeted metabolomics. J Proteome Res 2021;20:3124–33. https://doi.org/10.1021/acs.jproteome.1c00019.Search in Google Scholar PubMed

28. Akram, M, Iqbal, M, Daniyal, M, Khan, AU. Awareness and current knowledge of breast cancer. Biol Res 2017;50:33. https://doi.org/10.1186/s40659-017-0140-9.Search in Google Scholar PubMed PubMed Central

29. Lü, J, Zhao, Q, Guo, Y, Li, D, Xie, H, Liu, C, et al.. Regulation of ERα-dependent breast cancer metastasis by a miR-29a signaling. J Exp Clin Cancer Res 2023;42:93. https://doi.org/10.1186/s13046-023-02665-6.Search in Google Scholar PubMed PubMed Central

30. Ye, F, Dewanjee, S, Li, Y, Jha, NK, Chen, ZS, Kumar, A, et al.. Advancements in clinical aspects of targeted therapy and immunotherapy in breast cancer. Mol Cancer 2023;22:105. https://doi.org/10.1186/s12943-023-01805-y.Search in Google Scholar PubMed PubMed Central

31. Masuho, I, Kise, R, Gainza, P, Von Moo, E, Li, X, Tany, R, et al.. Rules and mechanisms governing G protein coupling selectivity of GPCRs. Cell Rep 2023;42:113173. https://doi.org/10.1016/j.celrep.2023.113173.Search in Google Scholar PubMed PubMed Central

32. Oldham, WM, Hamm, HE. Heterotrimeric G protein activation by G-protein-coupled receptors. Nat Rev Mol Cell Biol 2008;9:60–71. https://doi.org/10.1038/nrm2299.Search in Google Scholar PubMed

33. Liccardo, F, Luini, A, Di Martino, R. Endomembrane-based signaling by GPCRs and G-proteins. Cells 2022;11:528. https://doi.org/10.3390/cells11030528.Search in Google Scholar PubMed PubMed Central

34. Weis, WI, Kobilka, BK. The molecular basis of G protein-coupled receptor activation. Annu Rev Biochem 2018;87:897–919. https://doi.org/10.1146/annurev-biochem-060614-033910.Search in Google Scholar PubMed PubMed Central

35. Garcia-Marcos, M. Complementary biosensors reveal different G-protein signaling modes triggered by GPCRs and non-receptor activators. Elife 2021;10:e65620. https://doi.org/10.7554/elife.65620.Search in Google Scholar PubMed PubMed Central

36. Radhika, V, Dhanasekaran, N. Transforming G proteins. Oncogene 2001;20:1607–14. https://doi.org/10.1038/sj.onc.1204274.Search in Google Scholar PubMed

37. Hu, Z, Zhou, X, Zeng, D, Lai, J. Shikonin induces cell autophagy via modulating the microRNA-545-3p/guanine nucleotide binding protein beta polypeptide 1 axis, thereby disrupting cellular carcinogenesis in colon cancer. Bioengineered 2022;13:5928–41. https://doi.org/10.1080/21655979.2021.2024638.Search in Google Scholar PubMed PubMed Central

38. Chen, C, Huang, C, Liu, M, Zheng, J. Downregulation of guanine nucleotide-binding protein beta 1 (GNB1) is associated with worsened prognosis of clearcell renal cell carcinoma and is related to VEGF signaling pathway. J BUON 2017;22:1441–6.Search in Google Scholar

39. Naragoni, S, Sankella, S, Harris, K, Gray, WG. Phytoestrogens regulate mRNA and protein levels of guanine nucleotide-binding protein, beta-1 subunit (GNB1) in MCF-7 cells. J Cell Physiol 2009;219:584–94. https://doi.org/10.1002/jcp.21699.Search in Google Scholar PubMed PubMed Central

40. Petrovski, S, Küry, S, Myers, CT, Anyane-Yeboa, K, Cogné, B, Bialer, M, et al.. Germline de novo mutations in GNB1 cause severe neurodevelopmental disability, hypotonia, and seizures. Am J Hum Genet 2016;98:1001–10. https://doi.org/10.1016/j.ajhg.2016.03.011.Search in Google Scholar PubMed PubMed Central

41. Shi, Y, Jia, X, Xu, J. The new function of circRNA: translation. Clin Transl Oncol 2020;22:2162–9. https://doi.org/10.1007/s12094-020-02371-1.Search in Google Scholar PubMed

42. Zhang, Y, Luo, J, Yang, W, Ye, WC. CircRNAs in colorectal cancer: potential biomarkers and therapeutic targets. Cell Death Dis 2023;14:353. https://doi.org/10.1038/s41419-023-05881-2.Search in Google Scholar PubMed PubMed Central

43. Li, J, Sun, D, Pu, W, Wang, J, Peng, Y. Circular RNAs in cancer: biogenesis, function, and clinical significance. Trends Cancer 2020;6:319–36. https://doi.org/10.1016/j.trecan.2020.01.012.Search in Google Scholar PubMed

44. Zhang, W, Liu, T, Li, T, Zhao, X. Hsa_circRNA_102002 facilitates metastasis of papillary thyroid cancer through regulating miR-488-3p/HAS2 axis. Cancer Gene Ther 2021;28:279–93. https://doi.org/10.1038/s41417-020-00218-z.Search in Google Scholar PubMed PubMed Central

45. Cui, Y, Wu, X, Jin, J, Man, W, Li, J, Li, X, et al.. CircHERC1 promotes non-small cell lung cancer cell progression by sequestering FOXO1 in the cytoplasm and regulating the miR-142-3p-HMGB1 axis. Mol Cancer 2023;22:179. https://doi.org/10.1186/s12943-023-01888-7.Search in Google Scholar PubMed PubMed Central

46. Miao, Z, Li, J, Wang, Y, Shi, M, Gu, X, Zhang, X, et al.. Hsa_circ_0136666 stimulates gastric cancer progression and tumor immune escape by regulating the miR-375/PRKDC Axis and PD-L1 phosphorylation. Mol Cancer 2023;22:205. https://doi.org/10.1186/s12943-023-01883-y.Search in Google Scholar PubMed PubMed Central

Supplementary Material

This article contains supplementary material (https://doi.org/10.1515/oncologie-2024-0106).

Received: 2024-03-08
Accepted: 2024-05-28
Published Online: 2024-06-18

© 2024 the author(s), published by De Gruyter on behalf of Tech Science Press (TSP)

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Frontmatter
  2. Review Articles
  3. Autophagy and radiotherapy in esophageal cancer: modulating treatment sensitivity and overcoming challenges
  4. Functions of CAFs in microenvironment of non-small cell lung cancer: based on updated hallmarks of cancer
  5. Cisplatin-induced pyroptosis: a double-edged sword in cancer treatment
  6. Radiotherapy directed to inferior vena cava tumor thrombus among patients with renal cell carcinoma: an illustrative case and review of the literature
  7. Research Articles
  8. A lipid metabolism-related gene model reveals the prognosis and immune microenvironment of cutaneous melanoma
  9. Boanmycin induces apoptosis and overcomes venetoclax resistance in acute myeloid leukemia
  10. Identification of GNB1 as a downstream effector of the circRNA-0133711/miR-145-5p axis involved in breast cancer proliferation and metastasis
  11. Clinical characteristics and prognosis of lung metastases from unknown primary cancer sites
  12. Integrating bulk-RNA and single-cell analysis reveals heterogeneous expression of cuproptosis-related sorafenib-resistant genes in hepatocellular carcinoma
  13. Exploring the mechanism of genistein in treating hepatocellular carcinoma through network pharmacology and molecular docking
  14. Investigating the potential mechanisms of Litsea cubeba essential oil for anti-melanoma through experimental validation, network pharmacology, and molecular docking analysis
  15. Exploring the anti-lung cancer mechanism of Ganoderma lucidum and its relationship with the level of immune cell infiltration based on network pharmacology and molecular docking
  16. Constructing a prognostic model for colon cancer patients on basis of coagulation genes enriched in cancer-associated fibroblasts to guide personalized immunotherapy
  17. Rapid Communication
  18. Evaluation of HER2 immunohistochemistry-positive and immunohistochemistry-negative FISH amplification breast cancers using next-generation sequencing
  19. Short Commentary
  20. Unveiling the unexplored: shedding light on a novel aspect of colorectal carcinoma
https://doi.org/10.1515/oncologie-2024-0106
Keywords for this article
breast cancer; proliferation; metastasis; g protein beta-1; circular RNA
Creative Commons
BY 4.0

Articles in the same Issue

  1. Frontmatter
  2. Review Articles
  3. Autophagy and radiotherapy in esophageal cancer: modulating treatment sensitivity and overcoming challenges
  4. Functions of CAFs in microenvironment of non-small cell lung cancer: based on updated hallmarks of cancer
  5. Cisplatin-induced pyroptosis: a double-edged sword in cancer treatment
  6. Radiotherapy directed to inferior vena cava tumor thrombus among patients with renal cell carcinoma: an illustrative case and review of the literature
  7. Research Articles
  8. A lipid metabolism-related gene model reveals the prognosis and immune microenvironment of cutaneous melanoma
  9. Boanmycin induces apoptosis and overcomes venetoclax resistance in acute myeloid leukemia
  10. Identification of GNB1 as a downstream effector of the circRNA-0133711/miR-145-5p axis involved in breast cancer proliferation and metastasis
  11. Clinical characteristics and prognosis of lung metastases from unknown primary cancer sites
  12. Integrating bulk-RNA and single-cell analysis reveals heterogeneous expression of cuproptosis-related sorafenib-resistant genes in hepatocellular carcinoma
  13. Exploring the mechanism of genistein in treating hepatocellular carcinoma through network pharmacology and molecular docking
  14. Investigating the potential mechanisms of Litsea cubeba essential oil for anti-melanoma through experimental validation, network pharmacology, and molecular docking analysis
  15. Exploring the anti-lung cancer mechanism of Ganoderma lucidum and its relationship with the level of immune cell infiltration based on network pharmacology and molecular docking
  16. Constructing a prognostic model for colon cancer patients on basis of coagulation genes enriched in cancer-associated fibroblasts to guide personalized immunotherapy
  17. Rapid Communication
  18. Evaluation of HER2 immunohistochemistry-positive and immunohistochemistry-negative FISH amplification breast cancers using next-generation sequencing
  19. Short Commentary
  20. Unveiling the unexplored: shedding light on a novel aspect of colorectal carcinoma
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 12.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/oncologie-2024-0106/html
Scroll to top button