Expanding known dinoflagellate distributions: investigations of slurry cultures from Caspian Sea sediment

Introduction

The Caspian Sea is the largest inland body of water in the world with a surface area of 3.5 million km². It is a complex lake system with three distinct basins, of which the southern one is the most saline (13), the warmest (surface waters 10–28°C) and the deepest (1025 m) (Kosarev and Yablonskaya 1994). The hydrography of the lake is driven by riverine inputs (largely in the north) and seasonal climatic changes over its long latitudinal range (36°33′–47°07′N). The biota of the lake is dominated by freshwater/brackish species and is characterised by a large amount of endemism (Dumont 1998). Particular ecological pressures have been experienced in the lake system from pollution, oil and water exploitation and also, more recently, introduced species through shipping and the development of the Volga-Don canal. A recent driver of change in the plankton community has come from the introduced ctenophore Mnemiopsis leidyi A. Agassiz (Kideys et al. 2008, Roohi et al. 2010, Nasrollahzadeh et al. 2014). Phytoplankton communities have changed over the long term with fluctuation of freshwater input, changes in nutrient inputs and introduction of new species (Kosarev and Yablonskaya 1994). From 1994 to 2005, the productivity of the southern basin changed from oligotrophic to meso-eutrophic (Nasrollahzadeh et al. 2008a,b, Bagheri et al. 2011). Phytoplankton diversity for the Caspian is dominated by cyanophytes (147 taxa) and diatoms (238 taxa) (Gogorev 2006). However, with respect to dinoflagellates, it is notable that in the various studies of the phytoplankton flora of the Caspian most papers list only some 20–30 taxa (Table 1 and references therein). The total number of species recorded is just under 50 contrasting with a checklist for the Black Sea comprising 267 species (Gómez and Boicenco 2004) and for the Mediterranean comprising 673 species (Gómez 2003). Although low in species diversity, dinoflagellates are an important component of the phytoplankton community in terms of abundance and biomass (Kideys et al. 2005, Bagheri et al. 2012b, Nasrollahzadeh et al. 2014) with Prorocentrum Ehrenberg species being the most abundant (Kosarev and Yablonskaya 1994, Kideys et al. 2005). Blooms of Prorocentrum cordatum (Ostenfeld) Dodge (Bagheri and Fallahi 2014) and Heterocapsa F. Stein (Bagheri et al. 2012a) have been recorded and Lingulodinium polyedra (Stein) Dodge contributed to a bloom dominated by Nodularia Mertens ex Bordet et Flahault in 2009 (Nasrollahzadeh et al. 2011).

The sediment of the Caspian Sea has been the focus of a number of recent palynological studies investigating the history and geography of the basin (Leroy et al. 2006, 2007, 2011, 2013a,b,c, 2014), with descriptions and taxonomy of recent dinoflagellate cysts in Marret et al. (2004), Leroy et al. (2006) and Leroy (2010). Again the relative paucity of species is of note. A comparison of the literature from the plankton and sediment (Table 1) reveals that, with the exception of Gonyaulax baltica Ellegaard, Lewis et Harding, L. polyedra and Scrippsiella plana Luo, Mertens, Bagheri et Gu, little congruity exists between the two lists. This study was undertaken to explore this disparity and this paper documents preliminary investigations of southern Caspian Sea sediment designed to test the diversity of living dinoflagellates held in the sedimentary record.

Materials and methods

Grab samples were collected from a motorboat and the top 1-cm sediment was removed and placed in airtight, dark containers and kept in the cool and dark until processing. Stations 1–7 were taken along the Gorgan transect on 9 February 2014 with station 1 nearest to the shore (2 m deep) and station 7 furthest from the shore (13 m deep). Sample HCGA09 was taken 1.8 m depth in the Anzali Lagoon at 37°26′56.6N and 49°22′49.8E on 26 June 2008 (Figure 1).

Figure 1:

Location of grab samples in the Caspian Sea.

In the Gorgan transect, the station numbers are in italics and the water depths (m) in bold.

Initial work revealed that, apart from Lingulodinium polyedra, very low number of cysts with contents were found in the Caspian Sea sediment samples. Therefore, the approach of using slurry cultures to establish viability and diversity was initiated. For comparison, a single sediment sample from the Black Sea was also treated in the same way. Slurry cultures were established with approximately 1 cm³ wet sediment from each sample (Caspian Sea stations 1–7 and HCGA09, and Black Sea sample). These were briefly sonicated (ca. 2 min), sieved through a 80- and 20-μm mesh and the material retained on the 20-μm mesh was processed using the sodium polytungstate density gradient method as described in Bolch (1997). The recovered cysts were incubated as slurry cultures at 10°C, under fluorescent tubes, ~160 μmol photons m⁻² s⁻¹, 14:10 h light:dark cycle in 30-mm sterile Petri dishes with ca. 4 ml modified f/20 or f/2 medium without silicate (Guillard 1973). Medium was modified by the addition of sodium selenite (Na₂SeO₃, Sigma, St. Louis, MI, USA, final concentration 10⁻⁸m) and reducing copper sulfate (CuSO₄·5H₂O, BDH, Poole, UK, final concentration 10⁻⁸m) and prepared with 0.2-μm filtered natural seawater and distilled water – final salinity ca. 12). Single cells were isolated from the slurries using 96-well plates with 200 μl of modified f/20 or f/2 and incubated at 15°C, under fluorescent tubes, ~160 μmol photons m⁻² s⁻¹, 14:10 h light:dark cycle. Successful isolations were progressively scaled up through small Petri dishes to f/2 in 25-ml tissue culture flasks.

Cultures were observed on an inverted (Olympus IMT-2, Olympus, London, UK) or a dissecting microscope (Olympus SZH-ILLK, Olympus, London, UK). Detailed light microscopy of cells was carried out with an Olympus BH2 microscope (Olympus, London, UK) and photographed using a Zeiss Axioskop 2 microscope (Carl Zeiss Ltd., Cambridge, UK) with a Leica DFC290HS camera (Leica, London, UK) or a Nikon Eclipse Ci-L microscope, Nikon, Tokyo, Japan, fitted with a Nikon digital sight DS-Fi2 camera (Nikon, Tokyo, Japan) using NIS elements software (Nikon, Tokyo, Japan). Cell dissections were facilitated by the use of 2% sodium hypochlorite (Sigma-Aldrich, Gillingham, UK) and the plates were stained with Trypan blue (Sigma-Aldrich, Gillingham, UK) and examined under phase contrast optics. Dodge (1982), Steidinger (1997) and Hoppenrath et al. (2009) were used for initial identifications with follow up in primary literature as indicated in the species descriptions below.

For molecular work, cultures were harvested in the exponential growth phase. Approximately 15 ml of culture was centrifuged at 1537 g for 15 min. The supernatant was removed and the Deoxyribonuleic acid (DNA) was extracted using an Invisorb^® Spin Plant Mini Kit (Invisorb, Berlin, Germany), where 0.4 ml of lysis buffer from the kit was used to re-suspend the cell pellet and the lysis buffer was added to screw cap micro-centrifuge tubes containing 0.2 g glass beads (600 μm), the tubes were placed in a BioSpec 3110BX Mini-BeadBeater-1 (BioSpec, Bartlesville, USA) and the machine was run for 60 s at 4800 oscillations min⁻¹ to disrupt the cell membranes and lyse the DNA into solution. The remaining protocol was carried out in accordance with the manufacturer’s instructions and the DNA was re-suspended in 50 μl nuclease free water (Ambion, Thermo Fisher Scientific, Waltham, MA, USA). The primers D1R (5′ACCCGCTGAATTTAAGCATA 3′; Lenaers et al. 1989) and DC3Ca (5′ACGAACGATTTGCACGTCAG 3′; Scholin and Anderson 1994) were used to amplify a ca. 900 base pair region of the large-subunit (LSU) rRNA gene. The polymerase chain reaction (PCR) reactions contained a final volume of 50 μl consisting of 25 μl MYTAQ 2× master mix (Bioline, UK), 1–2 μl of template DNA (ca. 50 ng), 2 μl of each primer (0.5 μm final concentration) and made up to 50 μl with diethyl pyrocarbonate-treated water (Ambion, Thermo Fisher Scientific, Waltham, MA, USA). The reaction was then subjected to the following conditions in a thermo-cycler: an initial denaturation of 5 min at 95°C then 30 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min and then a final extension step of 72°C for 3 min. The products were checked by electrophoresis using 1% agarose gel (prepared with 1× tris-borate-ethylenediaminetetraacetic acid) and then purified using an Invisorb^® Fragment Cleanup. Sequences obtained in this study were subjected to an European Bioinformatics Institute (EMBL-EBI) Fasta 33 search (Pearson and Lipman 1988).

Phylogenetic trees were constructed using the Molecular Evolutionary Genetics Analysis (MEGA) version 7 (Kumar et al. 2016). Sequences from this study along with the matching top hits from the EMBL database and representative phylogenetic sequences from major groups of dinoflagellates were included in tree construction, Oxyrrhis marina Dujardin was used as an outgroup. The sequences were first aligned using ClustalW (Thompson et al. 1994). Phylogenetic analysis was performed using the maximum likelihood method based on the Tamura-Nei model (Tamura and Nei 1993). Bootstrap analysis (Felsenstein 1985) was also carried out with 500 replicates to provide confidence limits for tree branches. The tree was drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 43 nucleotide sequences. There were a total of 503 positions in the final dataset.

Results

Using the slurry culture approach, several hundred cells were isolated which resulted in some 30 successful cultures. Motile cells of Kryptoperidinium Lindemann, Gonyaulax Diesing, Gymnodinium F. Stein emend. Hansen et Moestrup, Lingulodinium Wall, Scrippsiella Balech and Woloszynskia Thompson were isolated (Table 2, Figures 2–31) and sequenced (Figure 32).

Figures 2–31:

Light micrographs of Caspian Sea dinoflagellates grown in culture from sediments.

(2–6) Gonyaulax baltica, culture CS-ST1-005. (2) Lateral view of cell showing cingulum offset. (3) Dorsal view of cell showing general shape and wide cingulum. (4) Antapical view of cell showing broad sulcus. (5) Ecdysed cell showing antapical spines. (6) Hypotheca of cell showing plate reticulation, smooth sulcus and intra plate growth bands. (7–10) Gonyaulax sp., culture CS-ST2-001. (7) Lateral view of cell showing general shape, cingulum offset, apical horn and antapical spine. (8) Ventral view of cell showing broad offset cingulum. (9) Dorsal view of cell in outline showing pronounced apical horn and definite shoulders. (10) Ecdysed theca showing solid antapical spine and heavy plate reticulation. (11–14) Gymnodinium aureolum. (11–13) Culture CS-ST7-009. (14) Culture A3. (11) Cell showing overall shape, central nucleus and radiating chloroplasts. (12) Ventral view of cell showing sulcal-cingulum arrangement. (13) Dorsal view of cell. (14) Cells in duplet. (15–20) Kryptoperidinium foliaceum. (15 and 19) Culture CS-ST1-007. (16 and 18) Culture CS-ST1-001. (17 and 20) Culture A6. (15) Ventral view of cell showing leaf-like curvature, central nucleus, median cingulum and eyespot. (16) Lateral view of cell showing dorso-ventral flattening and eyespot. (17) Theca stained with trypan blue. (18) Cysts in ventral view. (19) Cyst in lateral view. (20) Cysts in mucoid capsule. (21–25) Lingulodinium polyedra. (21 and 23) Culture CS-ST1-002. (22) Culture CS-ST1-004. (25) Culture CS-ST1-003. (21) Ventral view of cell showing cingulum offset and first apical plate. (22) Dorsal view of cell showing horse-shoe shaped nucleus. (23) Ecdysed hypotheca showing distinctive polyhedral shape and plate reticulation. (24) Squashed cell showing thecal plates. (25) Cyst from Station 1 sediment. (26–28) Scrippsiella acuminata. (26) Culture CS-ST2-006. (27–28) Culture D10. (26) Outline view of cell. (27) Outline view of cell. (28) Cyst formed in culture. (29–30) Woloszynskia sp. (29) Culture D3 showing cell with eyespot. (30) Cell showing general outline from culture D4. (31) Impagidinium caspienense from palynological preparation (core CS03/1 at 32 cm) showing archeopyle. Scale bars=10 μm.

Figure 32:

Molecular phylogeny of dinoflagellates isolated from the Caspian and Black Sea sediments inferred from partial large-subunit rDNA (LSU rDNA) sequences based on the maximum likelihood (ML) method.

Oxyrrhis marina was used as an outgroup. Numbers on branches represent ML bootstrap values for that node; bootstrap values >50% are shown. Sequences from isolates in this study are indicated in bold. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Scale bar=nucleotide substitutions per site. The analysis involved 42 nucleotide sequences. Sequences generated in this study are available from GenBank, Accessions KY921615-KY921624. There were a total of 503 positions in the final dataset.

Discussion

Gonyaulax baltica, Kolkwitziella acuta (Apstein) Elbrächter and Lingulodinium polyedra are the only species that have previously been recognised in both planktonic and sediment samples (Table 1). Of these, we have confirmed the presence of G. baltica and L. polyedra in Caspian Sea sediment. The cyst-theca relationship for Impagidinium caspienense (Figure 31) was recently elucidated by Mertens et al. (2017) as being linked to G. baltica. In common with other spiny gonyaulacoid cysts, the cyst morphology of G. baltica is strongly influenced by salinity and the form found in the Caspian is at one end of the spectrum of spine bearing with no process development evident. Thus when first described from Caspian sediment, rather than attribution to Spiniferites Mantell, it was attributed to the genus Impagidinium Stover et Evitt (Marret et al. 2004). However, the cyst form of G. baltica in its original description by Ellegaard et al. (2002) from Baltic sediment was of a more typical Spiniferites morphology although description was provided in that paper for substantial variation in form. Attribution to Impagidinium is questioned by Mertens et al. (2017) on the basis of some morphological features and also geography (other Impagidinium species being typically found offshore rather than in more coastal habitats). Further, molecular and detailed taxonomic studies involving both cysts and thecae in the wider Gonyaulax group provide evidence for the polyphyletic nature of Gonyaulax sensu lato. For now, however, they suggest the simplest solution is to retain the current dual classification of the cyst and motile stage, awaiting a more fundamental overhaul of Gonyaulax in the future. That there remains a great deal of work to clarify species in the Gonyaulacales has previously been highlighted (e.g. Lewis et al. 2001, Mertens et al. 2015a) and the presence of another unidentified Gonyaulax in this study also confirms that further work on the cyst-theca relationships in the Gonyaulacales is necessary.

Scrippsiella acuminata is recorded from Caspian sediment for the first time. Scrippsiella acuminata has previously been recognised in the plankton but not recorded in sediment samples. Scrippsiella species are common constituents of coastal sediment (Lewis 1991). Caspian sediment has largely been investigated using palynological techniques (references in Table 1). As a calcareous cyst with a thin inner organic wall, it seems likely that these cysts have been destroyed by the processing techniques used for these studies and hence the previous lack of records. This is the first record for Kryptoperidinium foliaceum, Gymnodinium aureolum and Woloszynskia sp. from the Caspian Sea. Woloszynskia pascheri (Suchlandt) von Stosch has been recorded from the Iranian rivers which flow into the Caspian (Zarei Darki 2009). It is possible that all of these species have been previously overlooked in the plankton samples – a number of Glenodinium Ehrenberg and Gymnodinium species have been recorded (see Table 1) some of which might be confused with these species. It can be especially difficult to speciate Gymnodinium species because of the difficulties of preserving them successfully. This was illustrated by Sundström et al. (2009) describing a new species of Gymnodinium from the extensively studied Baltic Sea which had not been recognised despite it being a relatively common member of the spring phytoplankton flora. Cysts have been described for both K. foliaceum (Figueroa et al. 2009) and G. aureolum (Tang et al. 2008), but neither has been recorded from Caspian sediment. Cysts are also known from the Woloszynskia genus (e.g. Kremp et al. 2005) but none has been recorded from Caspian sediment. Previous studies in the Caspian have been for geological purposes and so sediment has been processed by palynological means. It seems likely that the hyaline cysts of these species did not survive such harsh techniques or if they did, given their lack of paratabulation, they might not be recognised as such. However, the presence of cysts in sediment can be a useful way of providing an integrated record of occurrence of species that might be missed in the plankton and indeed K. foliaceum was recognised for the first time in the Mediterranean Sea by this route (Satta et al. 2013). Given the variety of Gymnodinium species recorded in the plankton, it would seem likely other cysts in this genus might also be present in the sediment.

Reviewing Table 1, other gaps can be highlighted between the two lists. Species of the following genera, Oblea Balech ex Loeblich et Loeblich III, Diplopsalis Bergh and some Protoperidinium Bergh, recorded in the plankton could be represented by the Brigantedinium Reid recorded in the dinocyst record. However, the presence of Protoperidinium leonis Pavillard in the plankton would suggest the distinctive Quinquecuspis Harland might also be recorded in the dinocyst record. It is hard to reconcile this lack – unless it is due to rarity. Heterocapsa triquetra (Ehrenberg) F. Stein recorded in the plankton also is not recorded in sediments. The presence of Pentapharsodinium dalei Indelicato et Loeblich III in the sedimentary record would suggest it should similarly be recorded in the plankton. Here there could be confusion with S. acuminata that is similar in morphology in the motile stage.

The approach of using sediment slurries has been invaluable for investigating the diversity of dinoflagellates in a region where intact cysts were relatively rare. Single cyst isolations are very helpful but, where there is a paucity of intact cysts, they are challenging. Using slurries offers the opportunity to develop cultures that can provide a wealth of taxonomic information as well as the possibility of cyst formation as demonstrated in this study. Our results also highlight the need for culturing to learn more about the interactions between motile stages and cysts, which would allow understanding of species origination over time linked to the palaeohydrological history of the Caspian Sea.