Altered expression profile of long non-coding RNAs during heart aging in mice
-
Xiuxiu Wang
, Bingjie Hua , Meixi Yu , Shenzhen Liu , Wenya Ma , Fengzhi Ding , Qi Huang , Lai Zhang , Chongwei Bi , Ye Yuan , Mengyu Jin , Tianyi Liu , Ying Yu , Benzhi Caiand Baofeng Yang
Abstract
Objective
Long noncoding RNAs (lncRNAs) play an important role in regulating the occurrence and development of cardiovascular diseases. However, the role of lncRNAs in heart aging remains poorly understood. The objective of this study was to identify differentially expressed lncRNAs in the heart of aging mice and elucidate the relevant regulatory pathways of cardiac aging.
Materials and methods
Echocardiography was used to detect the cardiac function of 18-months (aged) and 3-months (young) old C57BL/6 mice. Microarray analysis was performed to unravel the expression profiles of lncRNAs and mRNAs, and qRT-PCR to verify the highly dysregulated lncRNAs.
Results
Our results demonstrated that the heart function in aged mice was impaired relative to young ones. Microarray results showed that 155 lncRNAs were upregulated and 37 were downregulated, and 170 mRNAs were significantly upregulated and 44 were remarkably downregulated in aging hearts. Gene ontology analysis indicated that differentially expressed genes are mainly related to immune function, cell proliferation, copper ion response, and cellular cation homeostasis. KEGG pathway analysis showed that the differentially expressed mRNAs are related to cytokine-cytokine receptor interaction, inflammatory mediator regulation of TRP channels, and the NF-kappa B signaling pathway.
Conclusion
These results imply that the differentially expressed lncRNAs may regulate the development of heart aging. This study provides a new perspective on the potential effects and mechanisms of lncRNAs in heart aging.
1 Introduction
Aging refers to the phenomenon of the progressive decline of biological and physiological functions and of the organism's ability to adapt to metabolic stress and environmental changes, as a result of the impact generated by the accumulation of a wide variety of molecular and cellular damages over time[1]. Aging is also a major risk factor for most chronic diseases and functional impairments, especially cardiovascular disease, including myocardial infarction, atherosclerosis, heart failure, hypertension, and cardiac hypertrophy[2,3,4,5,6,7]. Recent studies have suggested that cold stress could cause myocardial remodeling and hypertension, and therefore might be a risk factor for heart aging[8–9]. Heart aging is accompanied by cardiac systolic and diastolic dysfunction and changes in cardiac structure, which are manifested in myocardial stiffness, loss of elasticity and narrowing of blood vessels, changes in blood components, etc[10]. Heart aging can be triggered by a variety of complex factors, including the decline of stem cell functionality and quantity[11], cardiomyocyte senescence[12], DNA damage[13], overproduction of reactive oxygen species (ROS) [14–15], and telomere shortening[13], as well as the activation of aging genes[6–7]. Some molecules and signaling pathways have also been found to be involved in the regulation of heart aging[16,17,18].
Long noncoding RNAs (lncRNAs), a newly discovered category of gene regulatory factors, are RNAs of more than 200 nucleotides without significant protein-coding capacity[19–20]. LncRNAs have been shown to play a key role in regulating the proliferation of non-small cell lung cancer cells[21], osteosarcoma cells[22], and ovarian cancer[23]. Furthermore, lncRNAs have also been recently recognized as critical regulators of the expression of genes key to the aging programs[24]. Evidence has been provided that silencing of lincRNAp21 can alleviate doxorubicin-induced cardiac senescence[25]. A study examined the expression of lncRNA Miat, Malat-1, Carmen, and Xist in the heart of rats of different ages (about days 248, 413, and 597) to study whether they could be used as cardiovascular biomarkers of aging[26]. Abdelmohsen et al. analyzed the expression of lncRNAs during the replicative aging process of fibroblasts and found that lncRNA xloc_023166 prevented aging[27]. Although some lncRNAs have been uncovered to play a vital role in regulating heart aging. The present study aimed to detect the expression profiles of lncRNAs in the hearts of young (3 months) and aged (18 months) mice and to identify the differentially expressed lncRNAs and analyze their potential regulatory roles in cardiac aging.
2 Materials and methods
2.1 Heart tissue collection
Male C57BL/6 mice (20–25 g) of 6–8 weeks were purchased from the Experimental Animal Center of the Affiliated Second Hospital of Harbin Medical University (Harbin, China). Mice were stochastically assigned to two groups: young mice (3 months) and aging mice (18 months). The mice were sacrificed at the age of 3 (for the young group) and 18 (for the aged group) months. The hearts were stored at −80°C for subsequent preparation of total RNA samples. The protocols involving the use of mice were approved by the Animal Ethics Committee of Harbin Medical University. The investigation procedures conform to the guidelines of the Care and Use of Laboratory Animals published by the US National Institutes of Health.
2.2 Echocardiography
Mice were anesthetized with tribromoethanol (0.02 g/10 g). Echocardiography with Vevo 1100 VisualSonics devices (VisualSonics, Toronto, ON, Canada) was performed to assess the cardiac function of aging and young mice. The short-axis view of M-mode was selected for the measurements of fractional shortening (FS) and ejection fraction (EF) as the main parameters of cardiac function.
2.3 Microarray
Total RNA samples were extracted from the hearts of three aging and three young mice, respectively, using the Trizol® Reagent (Invitrogen life technologies) and further purified by using RNasey Mini Kit (Qiagen p/n 74104). Next, the quantification and quality of RNA were measured using NanoDrop ND-1000. The RNAs were transcribed into cRNAs and labeled using Quick Amp Labeling Kit, One-Color (Agilent p/n 5190-0442). Then, nanodrop was used to detect the fluorescence labeling efficiency to ensure the reliability of subsequent chip experimental results. The labeled cRNAs were hybridized with a high-density chip using Agilent Gene Expression Hybridization Kit (Agilent p/n 5188–5242) and scanned by the Agilent Microarray Scanner (Agilent p/n G2565BA). Finally, the data were extracted by Agilent Feature Extraction (version 11.0.1.1). The microarray analysis was performed by Kangchen Biotech, Shanghai, P.R. China.
2.4 Microarray data analysis
The criteria for differential expression of lncRNAs and mRNAs with statistical significance between aging and young mice were set as P < 0.05 and | log2 fold change| > 2.
2.5 Gene Ontology and KEGG pathway analysis
GO (Gene Ontology) analysis of molecular function (MF), cellular components (CC), and biological processes (BP) of genes was carried out based on the GO database. The related signal pathways of differentially expressed mRNAs were analyzed by the KEGG database. Two-side Fisher's exact test was used to filter the GO category and pathways. P < 0.05 was set as the threshold for defining statistical significance, and a false discovery rate (FDR) was used to correct the P-value.
2.6 RNA extraction and Quantitative Real-Time PCR
Total RNA samples were extracted from myocardium of 3 and 18 months, using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA concentration and purity were determined with a NanoDrop ND-1000. A reverse transcription kit was used for reverse transcription of RNA to cDNA (TaKaRa, Tokyo, Japan). PCR was performed using GreenER Two-Step qRT-PCR Kit Universal (Invitrogen, USA).
The sequences of primer pairs used in this study include:
Up-regulated lncRNAs:
ENSMUST00000143329-F: AGGCATCCAGCATCCTTTCT,
-R: GGTAGACAGCACCTGAGGAA.
uc007bte.1-F: AGCATGAATCAGCAGGAGGA,
-R: TGAGAGAGGCAAGGCAAAGA.
uc007pgi.1-F: TGCGAGAAATCCCACCATCT,
-R: TCAGGCAGCCGATTATCACT.
uc009cfw.1-F: GCCTCCTTTGTCTTCCTCCT,
-R: TTGTCTGAGAGCTGCCTTGA.
ENSUMST00000162347-F: AGAGTCAATTCCCAGCACCA,
-R: CCCAGTAGGGTGTCACAGTT.
Down-regulated lncRNAs:
ENSMUST00000146359-F: CTACTGGCTGCTCGGACTAA,
-R: TACAGAGGAATGCGCCTGAT.
NR_045178-F: ATGGACAAAGCAGGATGTGC,
-R: AGCGTGAGAGTCTCTTGAGG.
TCONS_00008432-F: AAGCCTGCAAGGAAGAGACT,
-R: TTGCTTCCAGCATGTCCAAC.
ENSMUST00000180853-F: ATTCGAGAGGCGCTAGGAAA,
-R: GAAAGGGAACGCAAGGAAGG.
The GAPDH was used as internal control. 2−ΔΔCt was used to analysis the data.
2.7 Statistical Analysis
Two-tailed unpaired Student's t-test of the GraphPad Prism 7.0 program was used to compare the differences between the young and the aged mice. P < 0.05 was considered statistically significant.
3 Results
3.1 Alteration of cardiac function in aging mice
While there was no significant difference in the heart weight between aged and young mice (Fig. 1A), the cardiac function of aged mice was significantly impaired with markedly decreased EF and FS relative to the young counterparts (Fig. 1B–D). This result is an indication cardiac aging in 18-months old mice compared to 3-months old ones.

Reduced cardiac function in aging mice
(A) There was no difference in the heart weight ratio between the aging mice (N = 7) and young mice (N = 5), and the cardiac function was determined by echocardiography (B–D), N = 5. Data are shown as mean ± SEM. *P < 0.05 vs. young mice.
3.2 Aberrant lncRNAs and mRNAs in the heart of aging mice
To elucidate the potential molecular mechanisms for the observed impairment of cardiac function in aged mice, we performed a high-throughput microarray analysis to identify the differentially expressed lncRNAs and mRNAs between aged (N = 3) and young mice (N = 3). Clustering analysis was carried out to detect differential expression of lncRNAs (Fig. 2A) and mRNAs (Fig. 2B). Based on the criteria of fold change ≥2.0 and P < 0.05, 192 differentially expressed lncRNAs (Fig. 2C) and 214 differentially expressed mRNAs (Fig. 2D) were found, of which 155 lncRNAs were upregulated and 37 downregulated in the aged hearts relative to young ones. In addition, 170 mRNAs were up-regulated and 44 downregulated in aged mouse hearts. Table 1 and Table 2 show the 10 most significantly upregulated and downregulated lncRNAs and mRNAs in aged mouse hearts. The top five upregulated lncRNAs uc007pgi.1, uc009cfw.1, ENSMUST00000143329, ENSMUST00000162347 and uc007bte.1 (Fig. 2E and Table 3) and four downregulated lncRNAs TCONS_00008432, NR_045178, ENSMUST00000146359, and ENSMUST00000180853 (Fig. 2F and Table 3) were selected for qRT-PCR verification. Except for uc007pgi.1, uc009cfw.1, and ENSMUST00000162347, the differential expression of other 6 lncRNAs initially identified by microarray analysis were confirmed by qRT-PCR.
Ten most up- and downregulated lncRNA in the senile mice compared to the young mice tissues by volcano plot
| Seqname | Gene Symbol | Fold Change | P-Value | False discovery rate | Chromosome | Relationship | Regulation |
|---|---|---|---|---|---|---|---|
| uc007pgi.1 | Igh-A | 16.4211129 | 0.0123091017135 | 0.704002480 | chr12 | intergenic | up |
| uc009cfw.1 | M34473 | 11.9186002 | 0.0120988638993 | 0.703893166 | chr6 | intergenic | up |
| ENSMUST00000162347 | Gm16028 | 11.4247018 | 0.0002546295660 | 0.324552338 | chr1 | natural antisense | up |
| ENSMUST00000143329 | Pak7 | 11.2164783 | 0.0005184195769 | 0.352156281 | chr2 | exon sense-overlapping | up |
| uc007bte.1 | BC038927 | 9.8736198 | 0.0008021783571 | 0.389972717 | chr1 | intergenic | up |
| uc029tuy.1 | BC038927 | 9.0601077 | 0.0002724285562 | 0.324552338 | chr1_GL456221_random | exon sense-overlapping | up |
| uc029qqx.1 | BC038927 | 8.9514910 | 0.0003940837912 | 0.335359940 | chr1 | intergenic | up |
| ENSMUST00000127039 | Cpxm2 | 8.6573415 | 0.0316924115364 | 0.835551190 | chr7 | exon sense-overlapping | up |
| uc007bts.1 | BC038927 | 8.5146551 | 0.0005341530809 | 0.352156281 | chr1 | intergenic | up |
| ENSMUST00000149852 | Myh7 | 8.0777575 | 0.0031840612119 | 0.578467076 | chr14 | exon sense-overlapping | up |
| AK047207 | AK047207 | 18.5809419 | 0.0541673031371 | 0.90042180 | chr4_GL456350_random | intergenic | down |
| TCONS_00008432 | XLOC_006834 | 11.1899786 | 0.0096746130928 | 0.673876406 | chr13 | intergenic | down |
| NR_045178 | 1700042O10Rik | 10.1800255 | 0.0002896109249 | 0.324552338 | chr11 | intronic antisense | down |
| ENSMUST00000146359 | Ddc | 9.2777667 | 0.0055688768544 | 0.620442862 | chr11 | exon sense-overlapping | down |
| ENSMUST00000180853 | B430219N15Rik | 5.1778340 | 0.0038964965731 | 0.612011531 | chr10 | natural antisense | down |
| uc029usn.1 | Gm5859 | 4.7961460 | 0.0427001224829 | 0.890663465 | chr4 | intergenic | down |
| ENSMUST00000147230 | B430219N15Rik | 4.7234781 | 0.0019670790981 | 0.521930155 | chr10 | natural antisense | down |
| ENSMUST00000149439 | Wdr72 | 4.6269702 | 0.0002775462694 | 0.324552338 | chr9 | exon sense-overlapping | down |
| ENSMUST00000168048 | Gm17171 | 3.5947210 | 0.0127512174729 | 0.713277281 | chr2 | intronic antisense | down |
| ENSMUST00000095448 | E230001N04Rik | 3.5589724 | 0.0179762591263 | 0.759308574 | chr17 | intergenic | down |
Ten most up- and downregulated mRNA in the senile mice compared to the young mice tissues by volcano plot
| Gene Symbol | Fold Change | Regulation | P-Value | FDR | Chromosome |
|---|---|---|---|---|---|
| Cyp2b10 | 19.4177580 | up | 0.0012091 | 0.368406446 | cytochrome P450, family 2, subfamily b, polypeptide 10 |
| Klk1b21 | 18.1814910 | up | 0.0023379 | 0.420447958 | kallikrein 1-related peptidase b21 |
| Klk1b16 | 16.9975930 | up | 0.0005335 | 0.306936746 | kallikrein 1-related peptidase b16 |
| Klk1b27 | 16.867272 | up | 0.0030525 | 0.435434485 | kallikrein 1-related peptidase b27 |
| Ccl8 | 16.647476 | up | 0.0030389 | 0.435434485 | chemokine (C-C motif) ligand 8 |
| Klk1b26 | 16.595657 | up | 0.0004407 | 0.306936746 | kallikrein 1-related petidase b26 |
| Klk1b8 | 14.5656130 | up | 0.0002850 | 0.306936746 | kallikrein 1-related peptidase b8 |
| Cyp2b9 | 13.870040 | up | 0.0064780 | 0.505295448 | cytochrome P450, family 2, subfamily b, polypeptide 9 |
| Klk1b22 | 13.5142910 | up | 0.0009369 | 0.339547062 | kallikrein 1-related peptidase b22 |
| Egfbp2 | 12.8234330 | up | 0.0003858 | 0.306936746 | epidermal growth factor binding protein type B |
| Pkp1 | 8.5662940 | down | 0.0363041 | 0.727009964 | plakophilin 1 |
| 2210407C18Rik | 4.6002815 | down | 0.0284802 | 0.704663955 | RIKEN cDNA 2210407C18 gene |
| Lsp1 | 4.4957683 | down | 0.0001650 | 0.231154293 | lymphocyte specific 1 |
| Kcne1 | 3.8354920 | down | 0.0019954 | 0.398112975 | potassium voltage-gated channel, Isk-related subfamily, member 1 |
| Bcat1 | 3.7411754 | down | 0.0393461 | 0.727009964 | branched chain aminotransferase 1, cytosolic |
| Wdr72 | 3.5439451 | down | 0.0005649 | 0.306936746 | WD repeat domain 72 |
| Per2 | 3.4188627 | down | 0.0241152 | 0.684321395 | period circadian clock 2 |
| Lrat | 3.3565073 | down | 0.0347539 | 0.725192325 | lecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase) |
| Med13l | 3.1438580 | down | 0.0108414 | 0.571936897 | mediator complex subunit 13-like |
| Tmem100 | 2.9812499 | down | 0.0162492 | 0.625508937 | transmembrane protein 100 |

Differential expression of lncRNAs and mRNAs in cardiac tissues from aged and young mice
Hierarchical clustering and volcano plots of data from microarray analysis showing the differences in lncRNA (A, C) and mRNA (B, D) expression profiles in the hearts of aged mice relative to young mice. qRT-PCR verification of the upregulated lncRNAs (E) and downregulated lncRNAs (F).
Five up-regulated and four down-regulated lncRNA in the aging mice heart compared to the young mice tissues by qRT-PCR
| Sample | GAPDH (Ct) | uc007pgi.1 (Ct) | uc009cfw.1 (Ct) | ENSMUST00000 143329(Ct) | UC007bte.1 (Ct) | ENSMUST00000 162347 (Ct) | ENSMUST00000 146359 (Ct) | NR-045178 (Ct) | TCONS-00008432 (Ct) | ENSMUST00000 180853 (Ct) |
|---|---|---|---|---|---|---|---|---|---|---|
| Young | 17.6018 | 30.5075 | 31.4878 | 32.7336 | 28.7084 | 30.8973 | 32.8515 | 36.9808 | 35.9523 | Undetermined |
| Young | 24.9457 | 29.6875 | 33.6435 | Undetermined | 29.4312 | 28.5655 | 31.4305 | 30.6550 | 31.8039 | 34.1035 |
| Young | 18.6359 | 28.4475 | 29.0027 | 31.6887 | 28.7353 | 30.6615 | 30.5467 | 28.8232 | 31.9750 | 32.0288 |
| Young | 21.7831 | 27.7026 | Undetermined | 27.1878 | 27.2907 | 29.4938 | 30.2939 | 27.3035 | 31.2758 | 35.9406 |
| Young | 18.1955 | 27.9258 | 28.9289 | 27.3102 | 26.4704 | 30.8142 | 27.2946 | 33.1586 | ||
| Old | 16.9513 | 28.9224 | 30.3551 | 29.5674 | 29.8970 | 31.4611 | 37.1237 | 33.0738 | Undetermined | 30.8844 |
| Old | 21.2262 | 27.4433 | 35.9324 | 28.7717 | 26.1900 | 28.4325 | Undetermined | Undetermined | Undetermined | 35.0848 |
| Old | 16.6436 | 28.2656 | 29.3889 | 35.8320 | 28.1946 | 30.7540 | 36.5523 | 31.6621 | 34.8063 | 30.3491 |
| Old | 16.8656 | 30.4991 | Undetermined | 37.0713 | 25.5742 | 30.0247 | Undetermined | Undetermined | Undetermined | 32.0592 |
| Old | 17.4761 | 27.3305 | 34.9349 | 30.2778 | 25.4458 | Undetermined | 35.6645 | 36.9855 |
3.3 GO analysis of differentially expressed mRNAs in the aging hearts
To investigate the role of mRNAs in aged heart, GO analysis was performed to annotate the Biological Process (BP), Cellular Component (CC), and Molecular Function (MF) of deregulated mRNAs. The results revealed that the 214 deregulated mRNAs are mainly enriched in cell proliferation, immune system process, cellular metal ion homeostasis, and positive regulation of endothelial cell apoptotic process. More specifically, 170 upregulated mRNAs are mainly enriched in cell proliferation and immune system process (Fig. 3A), while 44 downregulated mRNAs are mainly enriched in cellular metal ion homeostasis and positive regulation of endothelial cell apoptotic process (Fig. 3B).

GO analysis of differentially expressed genes for their potential roles in regulating biological process (BP), cellular component (CC) and molecular function (MF)
The biological process of top ten upregulated (A) and downregulated (B) mRNAs predicted by Go analysis. The analysis of the cellular component for the upregulated (C) and downregulated (D) genes. (E and F) The predicted molecular function of upregulated and downregulated mRNAs, respectively.
Concerning cellular components, the upregulated mRNAs are enriched in extracellular space and extracellular region (Fig. 3C), and the downregulated transcripts are mainly enriched in membrane, plasma membrane protein complex, and apical plasma membrane (Fig. 3D). In regard with molecular function, the upregulated mRNAs were predicted to be largely related to the serine-type peptidase activity and serine hydrolase activity (Fig. 3E), and the downregulated genes are significantly enriched in protein binding, copper ion binding, and metal ion transmembrane transport activity (Fig. 3F).
3.4 KEGG analysis of altered mRNAs
We further analyzed the pathways associated with differentially expressed mRNAs. The results indicate that the differentially expressed genes are mostly related to 16 signaling pathways. Specifically, the upregulated mRNAs in aged mice are theoretically associated with endocrine-and other factor-regulated calcium reabsorption, renin-angiotensin system, arachidonic acid metabolism, and cytokine-cytokine receptor interaction (Fig. 4A). The downregulated mRNAs were predicted to participate in transcriptional dysregulation in cancer, systemic lupus erythematosus, the NF-kappa signaling pathway, and the thyroid hormone signaling pathway (Fig. 4B).

KEGG pathway analysis
The KEGG pathway enrichment analysis of the upregulated (A) and downregulated (B) mRNAs.
4 Discussion
In this study, we identified 192 lncRNAs and 214 mRNAs that are deregulated in their expression in aging heart relative to young ones through global expression profiling coupled with qRT-PCR analysis. Our finding suggests that some lncRNAs might be considered biomarkers of heart aging. Meanwhile, we also characterized by bioinformatics analysis the possible involvement of the differentially expressed mRNAs in certain signaling pathways thereby the cellular functionalities related to cardiac aging. Proper function and physiological status of the human body rely on well-organized structures, elegantly integrated functions, precise coordination, and delicate balance among various tissues and organs belonging to different physiological systems. The development of functional degeneration due to aging in any organ can induce global decline of the whole body. If aging starts in the heart, decline of physiological function of the whole body can quickly develop, because the heart is responsible for supplying nutrients, oxygen, and energy to all organs the human body. The impact of aging on the heart is mainly reflected in the degenerative changes in the structure and function of the heart, which leads to various cardiovascular diseases, and such deteriorations can spread eventually to all parts of the body. Therefore, delineating the key molecules that regulate heart aging will help us better understand the molecular mechanism of heart aging and work out the proper strategies to slow down the progression of heart aging process thereby retarding the associated aging process of the whole body.
A few lncRNAs have been reported to be involved in the regulation of aging and cardiovascular diseases. Knockdown of lncRNA RAMP2-AS1 inhibits the expression of RAMP2 to change endothelial cell function and promotes vascular aging[28]. LncRNA PRKG1-AS1 plays a vital role in skeletal muscle aging[29]. Inhibition of lncRNA-Safe expression attenuates MI-induced myocardial fibrosis while improving cardiac function[30]. LncDACH1 regulates cardiac repair through direct binding to PP1A protein[31]. LncRNA SNHG7 regulates cardiac remodeling via targeting miR-34-5p by acting as a ceRNA[32]. Although some studies have proved that lncRNA regulates heart aging[25,26,27], so far, the expression profiles of the aging heart is reported in two articles. For instance, it has been demonstrated that differentially altered mRNA, miRNA, lncRNA, and circRNA in the cardiac muscle (CM) and skeletal muscle (SM) were detected by high-throughput sequencing analysis in a model of aging pigs compared to that of younger pigs, leading to further understanding of the transcriptional regulatory mechanisms of aging myocardium[33]. Meanwhile, the whole mouse heart samples of 4 weeks of age (juvenile), 15 weeks of age (adolescent), 8 months of age (adult) and 22 months of age (elderly) were analyzed by RNA-sequencing[34]. However, firstly, a total of four lncRNAs with significant alterations during cardiac muscle aging in pigs, with a particularly small number of lncRNAs with significant differences, provided less information for subsequent studies on specific molecular mechanisms. Secondly, in murine cardiac aging, we just found more mRNAs with significant changes by RNA sequencing. Overall, current research on high-throughput sequencing of lncRNAs during cardiac aging is still very necessary. In this study, we compared the lncRNA expression profiles young (3 months) and aged (18 months) mice to identify the differentially expressed lncRNAs. We reasoned that the deregulated lncRNAs might be eventually developed as biomarkers of heart aging and even the whole-organism aging and might also lay the groundwork for future studies on the aging process. However, it remains unclear what cause the differential expression of lncRNAs in aging heart, and whether the differential expression is tissue specific and species conserved remains to yet be clarified. In addition, the timing of expression deregulation of each individual lncRNA also needs to be elucidated to determine whether the deregulation in the heart is secondary to, or caused by, the aging of other organs.
Another risk factor of cardiovascular diseases is cold stress which could well increase the incidence of cardiovascular events [35–36]. Cold exposure causes cardiac injury by suppressing the Nrf2-Keap1 signaling pathway[37], and this pathway also plays an important role in heart aging[17]. These findings imply that heart aging and cardiovascular diseases induced by cold stress may share some common signal pathways and signaling mediators. Therefore, the findings of the present study may also form the basis for investigating the cold stress-related diseases.
In addition to identifying the differential expression of cardiac mRNAs and lncRNAs between aged and young mice, the potential involvement of the aging-associated deregulated lncRNAs and mRNAs in many biological processes, including regulation of body fluid levels, immune system process, and cell proliferation was uncovered by GO analysis. As documented by a previous study, the immune system process is related to aging[38]. Additionally, 16 pathways revealed by KEGG analysis may play pivotal roles in aging, including endocrine- and other factor-regulated calcium reabsorption, renin-angiotensin system, inflammatory mediator regulation of TRP channels, and the NF-kappa B signaling pathway.
Acknowledgments
This work was supported by the National Natural Science Fund of China (81573434/81872857), and the Program for New Century Excellent Talents in Heilongjiang Provincial University (grant number 1252-NCET-013).
Ethical approval
All procedures performed in the animal studies were in accordance with the guidelines of Harbin Medical University for the care and use of animals described in the section on experimental methods.
Conflict of interests
Baofeng Yang is the Editor-in-Chief of the journal. The article was subject to the journal's standard procedures, with peer review handled independently of this member and the research groups.
Author contributions
Benzhi Cai conceived and designed the project, Xiuxiu Wang, Bingjie Hua, Meixi Yu, Shenzhen Liu, Wenya Ma, Fengzhi Ding, Qi Huang, Lai Zhang, Chongwei Bi, Ye Yuan, Mengyu Jin, Tianyi Liu, Ying Yu, Yu Liu conducted the experiments, collected the data and analyzed the data. Xiuxiu Wang, Bingjie Hua, wrote the manuscript, Benzhi Cai and Baofeng Yang revised this article and made the final approval of the version to be submitted. All authors have read and approved the manuscript.
References
[1] Khaltourina D, Matveyev Y, Alekseev A, et al. Aging fits the disease criteria of the international classification of diseases. Mech Ageing Dev, 2020; 189(366): 111230.10.1016/j.mad.2020.111230Search in Google Scholar PubMed
[2] Childs B G, Baker D J, Wijshake T, et al. Senescent intimal foam cells are deleterious at all stages of atherosclerosis. Science, 2016; 354(6311): 472–477.10.1126/science.aaf6659Search in Google Scholar PubMed PubMed Central
[3] Lakatta E G. Arterial and cardiac aging: major shareholders in cardiovascular disease enterprises: Part III: cellular and molecular clues to heart and arterial aging. Circulation, 2003; 107(3): 490–497.10.1161/01.CIR.0000048894.99865.02Search in Google Scholar
[4] Lakatta E G, Levy D. Arterial and cardiac aging: major shareholders in cardiovascular disease enterprises: Part II: the aging heart in health: links to heart disease. Circulation, 2003; 107(2): 346–354.10.1161/01.CIR.0000048893.62841.F7Search in Google Scholar PubMed
[5] Shih H, Lee B, Lee R J, et al. The aging heart and post-infarction left ventricular remodeling. J Am Coll Cardiol, 2011; 57(1): 9–17.10.1016/j.jacc.2010.08.623Search in Google Scholar PubMed PubMed Central
[6] Torella D, Rota M, Nurzynska D, et al. Cardiac stem cell and myocyte aging, heart failure, and insulin-like growth factor-1 overexpression. Circ Res, 2004; 94(4): 514–524.10.1161/01.RES.0000117306.10142.50Search in Google Scholar PubMed
[7] Zhao C, Li G, Li J. Non-coding RNAs and cardiac aging. Adv Exp Med Biol, 2020; 1229: 247–258.10.1007/978-981-15-1671-9_14Search in Google Scholar PubMed
[8] Wang X, Jiang Y, Bai Y, et al. Association between air temperature and the incidence of acute coronary heart disease in northeast China. Clin Interv Aging, 2020; 15: 47–52.10.2147/CIA.S235941Search in Google Scholar PubMed PubMed Central
[9] Liang J, Yin K, Cao X, et al. Attenuation of low ambient temperature-induced myocardial hypertrophy by atorvastatin via promoting Bcl-2 expression. Cell Physiol Biochem, 2017; 41(1): 286–295.10.1159/000456111Search in Google Scholar PubMed
[10] Li H M, Liu X, Meng Z Y, et al. Kanglexin delays heart aging by promoting mitophagy. Acta Pharmacol Sin, 2021, Online ahead of print.10.1038/s41401-021-00686-5Search in Google Scholar PubMed PubMed Central
[11] Li J, Li S H, Dong J, et al. Long-term repopulation of aged bone marrow stem cells using young Sca-1 cells promotes aged heart rejuvenation. Aging Cell, 2019; 18: e13026.10.1111/acel.13026Search in Google Scholar PubMed PubMed Central
[12] Li Q, Liu X, Wei J. Ageing related periostin expression increase from cardiac fibroblasts promotes cardiomyocytes senescent. Biochem Biophys Res Commun, 2014; 452(3): 497–502.10.1016/j.bbrc.2014.08.109Search in Google Scholar PubMed
[13] Moslehi J, DePinho R A, Sahin E. Telomeres and mitochondria in the aging heart. Circ Res, 2012; 110(9): 1226–1237.10.1161/CIRCRESAHA.111.246868Search in Google Scholar PubMed PubMed Central
[14] Petrosillo G, Matera M, Moro N, et al. Mitochondrial complex I dysfunction in rat heart with aging: critical role of reactive oxygen species and cardiolipin. Free Radic Biol Med, 2009; 46(1): 88–94.10.1016/j.freeradbiomed.2008.09.031Search in Google Scholar PubMed
[15] Martin-Fernandez B, Gredilla R. Mitochondria and oxidative stress in heart aging. Age (Dordr), 2016; 38(4): 225–238.10.1007/s11357-016-9933-ySearch in Google Scholar PubMed PubMed Central
[16] Ramos-Marques E, Garcia-Mendivil L, Perez-Zabalza M, et al. Chronological and biological aging of the human left ventricular myocardium: analysis of microRNAs contribution. Aging Cell, 2021; 20(7): e13383.10.1111/acel.13383Search in Google Scholar PubMed PubMed Central
[17] Chen K, Wang S, Sun Q W, et al. Klotho deficiency causes heart aging via impairing the Nrf2-GR pathway. Circ Res, 2021; 128(4): 492–507.10.1161/CIRCRESAHA.120.317348Search in Google Scholar PubMed PubMed Central
[18] Wen D T, Zheng L, Li J X, et al. The activation of cardiac dSir2-related pathways mediates physical exercise resistance to heart aging in old Drosophila. Aging (Albany NY), 2019; 11(17): 7274–7293.10.18632/aging.102261Search in Google Scholar PubMed PubMed Central
[19] Guttman M, Amit I, Garber M, et al. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature, 2009; 458(7235): 223–227.10.1038/nature07672Search in Google Scholar PubMed PubMed Central
[20] Guttman M, Russell P, Ingolia NT, et al. Ribosome profiling provides evidence that large noncoding RNAs do not encode proteins. Cell, 2013; 154(1): 240–251.10.1016/j.cell.2013.06.009Search in Google Scholar PubMed PubMed Central
[21] Chen Y, Zhou X, Huang C, et al. LncRNA PART1 promotes cell proliferation and progression in non-small-cell lung cancer cells via sponging miR-17-5p. J Cell Biochem, 2020; 122(3–4): 315–325.10.1002/jcb.29714Search in Google Scholar PubMed
[22] Chen H, Chen J. LncRNA SOX21-AS1 promotes the growth and invasiveness of osteosarcoma cells through miR-7-5p/IRS2 regulatory network. Arch Med Res, 2020; 52(3): 294–303.10.1016/j.arcmed.2020.11.007Search in Google Scholar PubMed
[23] Chen X J, An N. Long noncoding RNA ATB promotes ovarian cancer tumorigenesis by mediating histone H3 lysine 27 trimethylation through binding to EZH2. J Cell Mol Med, 2021; 25(1): 37–46.10.1111/jcmm.15329Search in Google Scholar PubMed PubMed Central
[24] Jae N, Heumuller A W, Fouani Y, et al. Long non-coding RNAs in vascular biology and disease. Vascul Pharmacol, 2019; 114(3): 13–22.10.1016/j.vph.2018.03.003Search in Google Scholar PubMed
[25] Xie Z, Xia W, Hou M. Long intergenic noncoding RNAp21 mediates cardiac senescence via the Wnt/betacatenin signaling pathway in doxorubicin-induced cardiotoxicity. Mol Med Rep, 2018; 17(2): 2695–2704.10.3892/mmr.2017.8169Search in Google Scholar
[26] Cabiati M, Sapio A, Salvadori C, et al. Evaluation of transcriptional levels of the natriuretic peptides, endothelin-1, adrenomedullin, their receptors and long non-coding RNAs in rat cardiac tissue as cardiovascular biomarkers of aging. Peptides, 2020; 123: 170173.10.1016/j.peptides.2019.170173Search in Google Scholar PubMed
[27] Abdelmohsen K, Panda A, Kang M J, et al. Senescence-associated lncRNAs: senescence-associated long noncoding RNAs. Aging Cell, 2013; 12(5): 890–900.10.1111/acel.12115Search in Google Scholar PubMed PubMed Central
[28] Lai C H, Chen A T, Burns A B, et al. RAMP2-AS1 regulates endothelial homeostasis and aging. Front Cell Dev Biol, 2021; 9: 635307.10.3389/fcell.2021.635307Search in Google Scholar PubMed PubMed Central
[29] Zheng Y, Liu T, Li Q, et al. Integrated analysis of long non-coding RNAs (lncRNAs) and mRNA expression profiles identifies lncRNA PRKG1-AS1 playing important roles in skeletal muscle aging. Aging (Albany NY), 2021; 13: 15044–15060.10.18632/aging.203067Search in Google Scholar PubMed PubMed Central
[30] Hao K, Lei W, Wu H, et al. LncRNA-Safe contributes to cardiac fibrosis through Safe-Sfrp2-HuR complex in mouse myocardial infarction. Theranostics, 2019; 9(24): 7282–7297.10.7150/thno.33920Search in Google Scholar PubMed PubMed Central
[31] Cai B, Ma W, Wang X, et al. Targeting LncDACH1 promotes cardiac repair and regeneration after myocardium infarction. Cell Death Differ, 2020; 27(7): 2158–2175.10.1038/s41418-020-0492-5Search in Google Scholar PubMed PubMed Central
[32] Wang J, Zhang S, Li X, et al. LncRNA SNHG7 promotes cardiac remodeling by upregulating ROCK1 via sponging miR-34-5p. Aging (Albany NY), 2020; 12(11): 10441–10456.10.18632/aging.103269Search in Google Scholar PubMed PubMed Central
[33] Chen J, Zou Q, Lv D, et al. Comprehensive transcriptional landscape of porcine cardiac and skeletal muscles reveals differences of aging. Oncotarget, 2018; 9(2): 1524–1541.10.18632/oncotarget.23290Search in Google Scholar PubMed PubMed Central
[34] Greenig M, Melville A, Huntley D, et al. Cross-sectional transcriptional analysis of the aging murine heart. Front Mol Biosci, 2020; 7: 565530.10.3389/fmolb.2020.565530Search in Google Scholar PubMed PubMed Central
[35] Yu W, Mengersen K, Wang X, et al. Daily average temperature and mortality among the elderly: a meta-analysis and systematic review of epidemiological evidence. Int J Biometeorol, 2012; 56(4): 569–581.10.1007/s00484-011-0497-3Search in Google Scholar PubMed
[36] von Klot S, Zanobetti A, Schwartz J. Influenza epidemics, seasonality, and the effects of cold weather on cardiac mortality. Environ Health, 2012; 11(1): 74.10.1186/1476-069X-11-74Search in Google Scholar PubMed PubMed Central
[37] Cong P, Liu Y, Liu N, et al. Cold exposure induced oxidative stress and apoptosis in the myocardium by inhibiting the Nrf2-Keap1 signaling pathway. BMC Cardiovasc Disord, 2018; 18(1): 36.10.1186/s12872-018-0748-xSearch in Google Scholar PubMed PubMed Central
[38] Dowery R, Benhamou D, Benchetrit E, et al. Peripheral B-cells repress B-cell regeneration in aging through a TNFalpha/IGFBP-1/IGF1 immune-endocrine axis. Blood, 2021, 138(19): 1817–1829.10.1182/blood.2021012428Search in Google Scholar PubMed
© 2022 Xiuxiu Wang et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Articles in the same Issue
- Review
- Dissecting pathophysiology of a human dominantly inherited disease, familial amyloidotic polyneuropathy, by using genetically engineered mice
- Effect of cold on knee osteoarthritis: Recent research status
- Original Article
- Effects of intermittent cold-exposure on culprit plaque morphology in ST-segment elevation myocardial infarction patients: a retrospective study based on optical coherence tomography
- A randomized retrospective clinical study on the choice between endodontic surgery and immediate implantation
- Challenges and improvement in management of neonates born to mothers with COVID-19 in China
- Nortriterpenoids from the fruit stalk of Schisandra chinensis (Turcz.) Baill.
- Altered expression profile of long non-coding RNAs during heart aging in mice
- Cryptotanshinone increases the sensitivity of liver cancer to sorafenib by inhibiting the STAT3/Snail/epithelial mesenchymal transition pathway
Articles in the same Issue
- Review
- Dissecting pathophysiology of a human dominantly inherited disease, familial amyloidotic polyneuropathy, by using genetically engineered mice
- Effect of cold on knee osteoarthritis: Recent research status
- Original Article
- Effects of intermittent cold-exposure on culprit plaque morphology in ST-segment elevation myocardial infarction patients: a retrospective study based on optical coherence tomography
- A randomized retrospective clinical study on the choice between endodontic surgery and immediate implantation
- Challenges and improvement in management of neonates born to mothers with COVID-19 in China
- Nortriterpenoids from the fruit stalk of Schisandra chinensis (Turcz.) Baill.
- Altered expression profile of long non-coding RNAs during heart aging in mice
- Cryptotanshinone increases the sensitivity of liver cancer to sorafenib by inhibiting the STAT3/Snail/epithelial mesenchymal transition pathway