The role of vitamin D receptor agonist on podocyte injury induced by high glucose
-
Zhiyuan Wang
Abstract
Background
The effects of vitamin D receptor (VDR) agonist paricalcitol on the podocyte injury induced by high glucose (HG) were investigated in conditioned immortalized mouse podocytes (MPC-5).
Methods
(1) Grouped according to different glucose concentrations: normal group (NG): 5.6 mmol/L glucose; HG stimulation group: 25 mmol/L glucose (25HG); high osmotic control group (NG+M): 5.6 mmol/L glucose + 19.4 mmol/L D-mannitol. The expression levels of VDR, podocyte marker proteins podocin, nephrin and mesenchymal marker proteins α-smooth muscle actin (α-SMA), matrix metalloproteinases (MMP9) in MPC-5 were measured, respectively. (2) Effect of VDR agonist-paricalcitol on podocyte epithelial-mesenchymal transition (EMT) induced by HG: cultured podocytes are divided into NG group, NG with dimethylsulfoxide (DMSO) group (NG+D), NG with paricalcitol (0.1 μmol/L) group (NG+P), HG group, HG with DMSO group (HG+D), and HG with paricalcitol (0.1 μmol/L) group (HG+P). The expression levels of VDR, podocyte marker proteins, marker proteins of mesenchymal cells, and the albumin flow in each group were then detected.
Results
(1) Under HG conditions, the expressions of VDR, podocin, and nephrin were decreased, while the expressions of α-SMA and MMP9 were increased (all P < 0.05). After administration of paricalcitol, the levels of VDR, podocin, and nephrin were increased, while the expressions of α-SMA and MMP9 were decreased compared with the control groups (all P < 0.05). (2) The results of albumin flow showed that the albumin flow of podocytes increased under the condition of HG, while it decreased after the treatment of paricalcitol.
Conclusion
The podocyte injury induced by HG could be partly rescued by Paricalcitol.
1 Introduction
Diabetic nephropathy (DN) is one of the major microvascular complications of diabetes [1]. Approximately 30% of diabetic patients will gradually progress to issues with their kidneys, eventually leading to DN [2, 3, 4]. Previous studies have suggested that the early stage of DN is concentrated in the glomerulus [5, 6]. Under the light microscope, glomerular hypertrophy, hyperplasia, basement membrane thickening, and mesangial cell proliferation were shown in DN [7]. With the progress of DN, glomerular sclerosis will gradually appear. However, these pathological changes can only represent a part of the reason for the change in the glomerular filtration rate [8, 9]. With further research on glomerular epithelial cells (podocytes), it is found that changes in the number and related functions of podocytes also play an important role in the progression of DN [5, 10].
The vitamin D receptor (VDR) belongs to the superfamily of nuclear hormone receptors, and encompasses receptors for steroid and thyroid hormones [11, 12]. VDR can be found in multiple kinds of tissues and cells, such as hepatocytes, islet cells, renal tubular epithelial cells, glomerular podocytes, and so on [13]. A recent study has shown that compared with wild-type mice, diabetic mice with VDR gene knockout are more prone to present severe proteinuria and glomerulosclerosis, along with the loss of podocytes [14, 15]. VDR activation or Vitamin D analogs can effectively reduce proteinuria in patients with DN [16, 17]. Therefore, VDR is closely related to the development of DN.
Paricalcitol (19-nor-1, 25-hydroxy-vitamin D2), a synthetic vitamin D analog, can take multiple protective effects on the kidney [18, 19]. In this experiment, VDR agonist paricalcitol was used to study the protective effect of VDR on podocyte phenotype and functional damage caused by high glucose (HG) in vitro.
2 Materials and Methods
2.1 Laboratory instruments and reagents
Ultra-low temperature refrigerator (SANYO Company, Osaka, Japan), liquid nitrogen container (Hengao Biotechnology Co., Ltd., Beijing, China), electronic balance (ARl530, OHAUS Company, American), dry type thermostat (GL.150B, Qilin Bell instrument company, Haimen, China), Ice machine (IEC-25, Xueni, Suzhou, China), western blot system (Tanon, Shanghai, China), infrared laser imaging system (Tanon, Shanghai, China), Paricalcitol (Abbott Company, San Francisco, USA), Dimethylsulfoxide (Dingguo Changsheng Co., Ltd., Beijing, China), cDNA synthesis kit for real-time quantitative PCR (FSQ-101, Toyobo, Japan), SYBR rapid quantitative PCR Kit (KR-0389, Kapa Company, Kapa Biosystems, Inc., Corston, UK), rabbit anti-mouse VDR polyclonal antibody, rabbit anti-mouse podocin polyclonal antibody, rabbit anti-mouse nephrin polyclonal antibody, and mouse anti-mouse α-smooth muscle actin (α-SMA) monoclonal antibody were obtained from Abcam, USA. Rabbit anti-mouse matrix metal-loproteinases (MMP9) polyclonal antibody was purchased from BBI Life Science (Shanghai, China) and mouse anti-mouse GAPDH monoclonal antibody was purchased from Zhongshanjinqiao Bio Company, Beijing. Horseradish peroxidase-labeled goat anti-mouse secondary antibody and goat anti-rabbit secondary antibody were acquired from Beijing Dingguo Changsheng Biotechnology Company.
2.2 Cell culture
First, the frozen podocytes were removed from liquid nitrogen, and thawed in 37°C to 42°C waters. Then, 3 mL culture medium was added, and centrifuged at 1000 rpm for 10 min. The supernatant was discarded, then resuspended by 3–4 mL of culture medium. The cell suspension was transferred to a culture flask and cultured in a 33°C incubator. After 16 h, adherence of the cells was observed and the medium was exchanged. For the podocytes in 33°C, the medium was exchanged every 2–3 d. The podocytes were able to undergo passage at approximately 80%–90% confluence. After trypsinization, pipette 1–2 mL of the cell suspension into a new culture flask, and then 2–3 mL of culture medium was added. The new culture flask was then placed in a 37°C incubator and the medium was exchanged every 2–3 d. The podocytes were cultured for 10–14 d for the subsequent experiments.
2.3 Western blotting analysis
The total protein of each group was extracted from the podocytes and the concentration of proteins was measured by BCA assay (Thermo Fisher, Waltham, USA). The total proteins were heated and denatured at 99°C for 5 min. Then the loading samples were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) gel electrophoresis and transferred to a polyvinylidene fluoride (PVDF) membrane. The PVDF membrane was blocked in 5% BSA at room temperature for 2 h. The primary antibody, VDR (1:200), nephrin (1:1000), podocin (1:1000), α-SMA (1:200), and MMP-9 (1:500), was incubated overnight at 4°C. The goat anti-mouse IgG secondary antibody (1:2000) and goat anti-rabbit secondary antibody (1:2000) were reacted at room temperature for 2 h. The image was performed by using the infrared laser imaging system, and the gray value of strips were measured by Image J and analyzed with GADPH as internal reference.
2.4 Real-time PCR
Total RNA was extracted using Trizol reagent (Invitrogen Inc.), according to the manufacturer’s instructions. The RNA purity was determined using absorbance at 260 nm and 280 nm (A260/280) and the cDNA was synthesized using the cDNA synthesis kit. The sequences of specific primers used in the present study are shown in Table 1. In KAPA SYBR rapid quantitative PCR Master Mix, the cDNA (2 μL) was mixed with 10 nmol/L forward and reverse primers (0.8 μL each), 2 × PCR Master Mix (10 μL) and RNase free water (in total volume of 20 μL); the reaction was performed in a thermocycler (BD Diagnostics, Sparks, MD, USA) under the conditions of cycle as follows: (1) pre-denaturation at 95°C for 3 min; (2) denaturation at 95°C for 5 s; (3) annealing at 60°C for 30 s; and (4) extension at 72°C for 35 s; a total of 40 cycles.
The sequences of primers used in the present study.
| Name | Sequences |
|---|---|
| VDR | Upstream: 5′TCCTTCCTCTGCTGGTAT3′ |
| Downstream: 5′CTCCTTGGTTAGTGTGGTAG3′ | |
| Nephrin | Upstream: 5′ACTGGAGGAATGTAGGTAATG3′ |
| Downstream: 5′TGTGTTCTTGCTTCTGTGA3′ | |
| Podocin | Upstream: 5′AGAAGAGGAGAAGGAGTT3′ |
| Downstream: 5′TTGGAGTTGAATGGTGTT3′ | |
| α-SMA | Upstream: 5′AACTGTGAATGTCCTGTG3′ |
| Downstream: 5′CATAGGTAACGAGTCAGAG3′ | |
| MMP9 | Upstream: 5′ACACGACATCTTCCAGTA3′ |
| Downstream: 5′CACCTTGTTCACCTCATT3′ | |
| GAPDH | Upstream: 5′AGTGGCAAAGTGGAGATT3′ |
| Downstream: 5′GTGGAGTCATACTGGAACA3′ |
VDR, vitamin D receptor; α-SMA, α-smooth muscle actin; MMP9, matrix metalloproteinases; GADPH, Glyceraldehyde-3-phosphate dehydrogenase.
2.5 Detection of podocyte monolayer barrier function
When the podocytes grew to a certain density and matured, the cells were uniformly inoculated onto the fibrous membrane of the Transwell chamber. After 24–36 h, when the cells grew to 80%–90% confluence, they were starved by replacing with fetal bovine serum-free medium for 6–8 h. Different treatment conditions were added to the upper layer of the Transwell chamber, and after 36 h, the cells were washed with sterilized PBS thrice. Then, the medium in the upper part of the chamber was discarded and replaced with 0.3 mL roswell park memorial institute (RPMI) 1640 medium containing 40 mg/mL albumin, while the medium in the lower part was replaced with 1 mL RPMI 1640 medium. The cells were cultured under 37°C for 1 h, then the sub-compartment medium was collected and the protein concentration was detected using the bicinchoninic acid (BCA) assay kit.
2.6 Statistical analysis
The data are expressed as means ± SD. SPSS 17.0 software (IGM, Chicago, IL, USA) was used for the statistical analysis and the test of intergroup significance of the measurement data was performed by one-way analysis of variance.
3 Results
3.1 Changes in podocytes phenotype and function under high-glucose treatments
3.1.1 Changes in podocyte phenotypes under different concentrations of glucose
To determine the effect of HG on the changes in podocyte phenotypes, we exerted different glucose concentrations on the podocytes. The results of western blot showed that the expression levels of nephrin, podocin, α-SMA, and MMP9 in the normal group (NG) were not significantly different compared with that of the hypertonic control group (NG+M, P > 0.05); Under the stimulation of HG (12.5G and 25G), the expressions of VDR, nephrin, and podocin proteins were reduced compared with that of the NG and the NG+M. The protein levels were decreased followed with the increase of glucose concentration (P < 0.05). Moreover, compared with the NG, the protein expressions of α-SMA and MMP9 were increased under the condition of HG stimulation, and the protein expressions were also upregulated with the increase in glucose concentration (P < 0.05) (Figure 1A, B). The results of qPCR were consistent with its protein levels (Figure 1C, D). Compared with the normal glucose concentration, the expression levels of VDR and podocyte marker proteins, nephrin and podocin, were decreased in the HG environment, and its mRNA levels decreased with the increase in glucose concentration (P < 0.05). Additionally, the mRNA levels of α-SMA and MMP9 were elevated with the increase in glucose concentration (P < 0.05).
The protein and mRNA levels of nephrin, podocin, α-SMA, and MMP9 under different concentrations of glucose. The lysate of cultured podocytes was used to do protein blotting and RNA extraction. (A) Western blotting analysis showed podocin, nephrin, VDR, and GAPDH expressions. (B) Protein expressions of MMP9, α-SMA, and GAPDH. (C) and (D) qRT-PCR showed mRNA expression of podocyte marker proteins, VDR and podocyte injury proteins. Compared with the NG group, Pabc < 0.05. α-SMA, α-smooth muscle actin; VDR, vitamin D receptor; 12.5G, 12.5 mmol/L glucose; 25G, 25 mmol/L glucose; NG, normal group; M, Mannitol; MMP9, matrix metalloproteinases; GADPH, Glyceraldehyde-3-phosphate dehydrogenase.
3.1.2 Changes in podocyte monolayer barrier function under HG conditions
To detect whether the podocytes with altered phenotypes under HG conditions exist functional impairment, albumin influx measured by the Transwell chamber were utilized to assess the monolayer barrier function of podocytes. The results showed that albumin inflow was increased in the 12.5 G group and the 25 G group compared with the NG (Figure 2 and Table 2), and the difference was statistically significant (P < 0.05). Our results indicated that the podocytes with altered phenotypes under HG also presented impaired monolayer barrier functions.
Function of podocytes under hyperglycemic treatment. Transwell analysis was used to analyze the albumin influx. Companied with HG treatment, the albumin influx was increased, indicating podocyte injury. Note: Compared with NG group, Pa < 0.05. 12.5G, 12.5 mmol/L glucose; 25G, 25 mmol/L glucose; HG, high glucose; NG, normal group.
3.2 Protective effect of paricalcitol on the changes in podocyte phenotype and the impairment of barrier function induced by HG
3.2.1 Protective effects of paricalcitol on the phenotypic damage of podocytes induced by HG
To examine the effect of paricalcitol on the changes in podocyte phenotype, western blot and qPCR were utilized to assess its protective role on HG induced podocyte injury. The results of qRT-PCR (Figure 3) showed mRNA expressions of these factors. The mRNA levels of VDR, nephrin, and podocin were also decreased in HG concentration conditions compared with that of the normal control group (P < 0.05). However, the mRNA expression levels of VDR, nephrin, and podocin were increased in the HG group after adding paricalcitol (P < 0.05). Moreover, compared with that of the normal control group, α-SMA, MMP9 mRNA levels were elevated in HG conditions (P < 0.05), and the expressions of α-SMA and MMP9 conversely decreased when paricalcitol was added to podocytes under HG (P < 0.05).
The protective role of VDR agonist (paricalcitol) on podocytes injury induced by HG. qRT-PCR showed mRNA expression of VDR, nephrin, podocin, α-SMA, and MMP9 under different treatments. VDR, nephrin, and podocin expressions were increased by paricalcitol, but α-SMA and MMP9 expressions were decreased. Compared with NG the group, Pa < 0.05 compared with 25G group, Pb < 0.05. α-SMA, α-smooth muscle actin; HG, high glucose; 25G, 25 mmol/L glucose; NG, normal group; VDR, vitamin D receptor; P, Paricalcitol; D, dimethylsulfoxide.
3.2.2 Protective effects of paricalcitol on damage of podocyte barrier function caused by HG
In order to find out whether paricalcitol can alleviate the damage of podocyte barrier function caused by HG, we measured the albumin flow using the Transwell to evaluate the podocyte monolayer barrier function. The study found that the albumin influx increased in the 25HG group compared with the normal control group, and the albumin flow decreased in the paricalcitol group compared with the 25HG group (Figure 4 and Table 3), and the difference was statistically significant (P < 0.05). The results indicated that paricalcitol can relieve the damage of podocyte barrier function caused by HG.
Effect of paricalcitol on barrier function of mature podocytes under the HG treatment. Transwell analysis was used to analyze the albumin influx. Compared with the NG group, Pa < 0.05, compared with 25G group, Pb < 0.05. 25G, 25 mmol/L glucose; NG, normal group; PAR, Paricalcitol.
4 Discussion
The capillary loops of glomerulus comprise three structures: capillary endothelial cells, glomerular basement membrane (GBM), and visceral epithelial cells (i.e. podocytes). Among them, podocytes are terminally differentiated cells coated on the basement membrane of the glomerulus. From the cell body, podocytes can give off larger primary processes, and then give off secondary processes to the GBM, which is the foot process [10, 20]. A 20–30 nm wide crack is formed between adjacent foot processes and they are connected by a permeable slit-diaphragm (SD). A variety of podocyte marker proteins and backbone proteins are distributed on the cracked diaphragm, and their integrity is key to determining the permeability of the glomerular filtration barrier [21]. Therefore, they constitute the last barrier of plasma albumin filtration together [22, 23, 24]. With the continuous in-depth research on glomerular visceral epithelial cells (podocytes), it has also been found that in the early stage of DN, pathological changes such as podocyte hypertrophy, foot process enfacement, reduced number of foot processes, and the increased gap between them accompanied by structural dysfunction were observed under electron microscope. As such, the impairment and loss of podocytes are involved in the development of proteinuria in DN. Podocytes are considered to be key to the development and progression of DN [25, 26]. In addition, recent studies have shown that the injury of podocytes is an important link in the development and progression of multiple kidney diseases [27].
VDR is a member of the superfamily of steroid and parathyroid hormone nuclear receptors, and it can be found in a variety of tissues and cells, such as hepatocyte, pancreatic islet cell, renal tubular epithelial cells, and glomerular podocytes [12, 28]. Vitamin D (VD)—VDR signaling system not only plays a role in maintaining the balance of calcium and phosphorus metabolism in the body, but also affects the synthesis of some proteins by regulating the transcription and expression of related genes, which plays an imperative role in the physiological and biochemical regulation of the body [29]. Compared with diabetic wild-type mice, VDR knockout mice have increased expression of fibronectin and reduced nephrin levels [30]. The results of this study also showed that the expression of VDR in podocytes decreased and podocyte injury occurred under the HG treatment.
Nephrin and podocin are distributed on the SD of podocyte, which are encoded by the NPHS1 and NPHS2 genes, respectively [31]. They are the structural proteins on the SD, which can be interconnected with other molecules in the SD, such as backbone proteins, to maintain the integrity and normal permeability of the SD [32, 33]. The results of this experiment showed that the protein expression of nephrin and podocin decreased under HG stimulation, and conversely, the expression of nephrin and podocin increased relatively after the administration of paricalcitol, the VDR agonist [34].
α-SMA and MMP9 are specific marker proteins of mesenchymal cells [35]. Overexpression of α-SMA in non-smooth muscle cells usually represents the occurrence of mesenchymal trans-differentiation [36]. In this study, the protein levels of α-SMA and MMP9 are increased under the stimulation of HG, and its expression will be relatively reduced after adding the VDR agonist paricalcitol.
The detection of podocyte monolayers barrier function treated with different treatments by Transwell suggest that HG induces epithelial-mesenchymal transition (EMT) in podocytes, resulting in the loss of structural proteins on the SD, which in turn damages the integrity of the SD and leads to impaired glomerular filtration barrier function. However, the podocyte albumin flow was decreased after the treatment of VDR agonist paricalcitol, indicating that paricalcitol can alleviate the impairment of podocyte barrier function caused by HG.
In short, podocyte expression of VDR is decreased and podocyte injury occurs in the HG environment, and the VDR agonist paricalcitol can alleviate the damage of podocyte phenotype and barrier function caused by HG. Therefore, VDR activation is one of the pathways to block podocyte EMT. However, the inner regulatory mechanism of VDR’s protective effect on the kidney has not been clarified yet, and further research is required.
Source of Funding
Nil.
Conflict of Interest
The authors have declared no conflict of interest.
REFERENCES
[1] Vaiserman A, Lushchak O. Developmental origins of type 2 diabetes: Focus on epigenetics. Ageing Res Rev 2019; 55: 100957.10.1016/j.arr.2019.100957Suche in Google Scholar
[2] Johansen KL, Chertow GM, Foley RN, Gilbertson DT, Herzog CA, Ishani A, et al. US Renal Data System 2020 Annual Data Report: Epidemiology of Kidney Disease in the United States. Am J Kidney Dis 202; 77: A7–A8.10.1053/j.ajkd.2021.01.002Suche in Google Scholar
[3] Pawar KB, Desai S, Bhonde RR, Bhole RP, Deshmukh AA. Wound with Diabetes: Present Scenario and Future. Curr Diabetes Rev 2021; 17: 136–42.10.2174/1573399816666200703180137Suche in Google Scholar
[4] Zhang L, Wang F, Wang L, Wang W, Liu B, Liu J, et al. Prevalence of chronic kidney disease in China: a cross-sectional survey. Lancet 2012; 379: 815–22.10.1016/S0140-6736(12)60033-6Suche in Google Scholar
[5] Mahtal N, Lenoir O, Tharaux PL. Glomerular Endothelial Cell Crosstalk With Podocytes in Diabetic Kidney Disease. Front Med (Lausanne) 2021; 8: 659013.10.3389/fmed.2021.659013Suche in Google Scholar PubMed PubMed Central
[6] Paul S, Ali A, Katare R. Molecular complexities underlying the vascular complications of diabetes mellitus - A comprehensive review. J Diabetes Complications 2020; 34: 107613.10.1016/j.jdiacomp.2020.107613Suche in Google Scholar PubMed
[7] Fu H, Liu S, Bastacky SI, Wang X, Tian XJ, Zhou D. Diabetic kidney diseases revisited: A new perspective for a new era. Mol Metab 2019; 30: 250–63.10.1016/j.molmet.2019.10.005Suche in Google Scholar PubMed PubMed Central
[8] Shichiri M, Kishikawa H, Ohkubo Y, Wake N. Long-term results of the Kumamoto Study on optimal diabetes control in type 2 diabetic patients. Diabetes Care 2000; 23: B21–9.Suche in Google Scholar
[9] Wada J, Makino H. Inflammation and the pathogenesis of diabetic nephropathy. Clin Sci 2013; 124: 139–52.10.1042/CS20120198Suche in Google Scholar PubMed
[10] Nishi H, Nangaku M. Podocyte lipotoxicity in diabetic kidney disease. Kidney Int 2019; 96: 809–12.10.1016/j.kint.2019.07.013Suche in Google Scholar PubMed
[11] Li A, Yi B, Han H, Yang S, Hu Z, Zheng L, et al. Vitamin D-VDR (vitamin D receptor) regulates defective autophagy in renal tubular epithelial cell in streptozotocin-induced diabetic mice via the AMPK pathway. Autophagy 2022; 18: 877–90.10.1080/15548627.2021.1962681Suche in Google Scholar PubMed PubMed Central
[12] Wei Z, Yoshihara E, He N, Hah N, Fan W, Pinto AFM, et al. Vitamin D Switches BAF Complexes to Protect β Cells. Cell 2018; 173: 1135–49.e15.10.1016/j.cell.2018.04.013Suche in Google Scholar PubMed PubMed Central
[13] Guan X, Yang H, Zhang W, Wang H, Liao L. Vitamin D receptor and its protective role in diabetic nephropathy. Chin Med J (Engl) 2014; 127: 365–9.10.3760/cma.j.issn.0366-6999.20131859Suche in Google Scholar
[14] Zhang Z, Sun L, Wang Y, Ning G, Minto AW, Kong J, et al. Renoprotective role of the vitamin D receptor in diabetic nephropathy. Kidney Int 2007; 73: 163–71.10.1038/sj.ki.5002572Suche in Google Scholar PubMed
[15] Delrue C, Speeckaert R, Delanghe JR, Speeckaert MM. The Role of Vitamin D in Diabetic Nephropathy: A Translational Approach. Int J Mol Sci 2022; 23: 807.10.3390/ijms23020807Suche in Google Scholar PubMed PubMed Central
[16] Zhang Y, Kong J, Deb DK, Chang A, Li YC. Vitamin D receptor attenuates renal fibrosis by suppressing the renin-angiotensin system. J Am Soc Nephrol 2010; 21: 966–73.10.1681/ASN.2009080872Suche in Google Scholar PubMed PubMed Central
[17] Wang B, Qian JY, Tang TT, Lin LL, Yu N, Guo HL, et al. VDR/Atg3 Axis Regulates Slit Diaphragm to Tight Junction Transition via p62-Mediated Autophagy Pathway in Diabetic Nephropathy. Diabetes 2021; 70: 2639–51.10.2337/db21-0205Suche in Google Scholar PubMed
[18] Jia R, Yang F, Yan P, Ma L, Yang L, Li L. Paricalcitol inhibits oxidative stress-induced cell senescence of the bile duct epithelium dependent on modulating Sirt1 pathway in cholestatic mice. Free Radic Biol Med 2021; 169: 158–68.10.1016/j.freeradbiomed.2021.04.019Suche in Google Scholar PubMed
[19] Martínez-Arias L, Panizo S, Alonso-Montes C, Martín-Vírgala J, Martín-Carro B, Fernández-Villabrille S, et al. Effects of calcitriol and paricalcitol on renal fibrosis in CKD. Nephrol Dial Transplant 2021; 36: 793–803.10.1093/ndt/gfaa373Suche in Google Scholar PubMed
[20] Artelt N, Ludwig TA, Rogge H, Kavvadas P, Siegerist F, Blumenthal A, et al. The Role of Palladin in Podocytes. J Am Soc Nephrol 2018; 29: 1662–78.10.1681/ASN.2017091039Suche in Google Scholar PubMed PubMed Central
[21] Müller-Deile J, Dannenberg J, Schroder P, Lin MH, Miner JH, Chen R, et al. Podocytes regulate the glomerular basement membrane protein nephronectin by means of miR-378a-3p in glomerular diseases. Kidney Int 2017; 92: 836–49.10.1016/j.kint.2017.03.005Suche in Google Scholar PubMed PubMed Central
[22] Fukasawa H, Bornheimer S, Kudlicka K, Farquhar MG. Slit diaphragms contain tight junction proteins. J Am Soc Nephrol 2009; 20: 1491–53.10.1681/ASN.2008101117Suche in Google Scholar PubMed PubMed Central
[23] Helal I, Fick-Brosnahan GM, Reed-Gitomer B, Schrier RW. Glomerular hyperfiltration: definitions, mechanisms and clinical implications. Nat Rev Nephrol 2012; 8: 293–300.10.1038/nrneph.2012.19Suche in Google Scholar PubMed
[24] Piwkowska A, Rogacka D, Audzeyenka I, Kasztan M, Angielski S, Jankowski M. Insulin increases glomerular filtration barrier permeability through PKGIα-dependent mobilization of BKCa channels in cultured rat podocytes. Biochim Biophys Acta 2015; 1852: 1599–609.10.1016/j.bbadis.2015.04.024Suche in Google Scholar PubMed
[25] Ziyadeh FN, Wolf G. Pathogenesis of the podocytopathy and proteinuria in diabetic glomerulopathy. Curr Diabetes Rev 2008; 4: 39–45.10.2174/157339908783502370Suche in Google Scholar PubMed
[26] Tagawa A, Yasuda M, Kume S, Yamahara K, Nakazawa J, Chin-Kanasaki M, et al. Impaired Podocyte Autophagy Exacerbates Proteinuria in Diabetic Nephropathy. Diabetes 2016; 65: 755–67.10.2337/db15-0473Suche in Google Scholar PubMed
[27] Thomas MC, Brownlee M, Susztak K, Sharma K, Jandeleit-Dahm KA, Zoungas S, et al. Diabetic kidney disease. Nat Rev Dis Primers 2015; 1: 15018.10.1038/nrdp.2015.18Suche in Google Scholar PubMed PubMed Central
[28] Palomer X, Gonzalez-Clemente JM, Blanco-Vaca F, Mauricio D. Role of vitamin D in the pathogenesis of type 2 diabetes mellitus. Diabetes Obes Metab 2008; 10: 185–97.10.1111/j.1463-1326.2007.00710.xSuche in Google Scholar PubMed
[29] Dong B, Zhou Y, Wang W, Scott J, Kim K, Sun Z, at al. Vitamin D Receptor Activation in Liver Macrophages Ameliorates Hepatic Inflammation, Steatosis, and Insulin Resistance in Mice. Hepatology 2020; 71: 1559–74.10.1002/hep.30937Suche in Google Scholar PubMed
[30] Hu Z, Zhang H, Yi B, Yang S, Liu J, Hu J, et al. VDR activation attenuate cisplatin induced AKI by inhibiting ferroptosis. Cell Death Dis 2020; 11: 73.10.1038/s41419-020-2256-zSuche in Google Scholar PubMed PubMed Central
[31] Cheng Q, Pan J, Zhou ZL, Yin F, Xie HY, Chen PP, et al. Caspase-11/4 and gasdermin D-mediated pyroptosis contributes to podocyte injury in mouse diabetic nephropathy. Acta Pharmacol Sin 2021; 42: 954–63.10.1038/s41401-020-00525-zSuche in Google Scholar PubMed PubMed Central
[32] Kang MK, Kim SI, Oh SY, Na W, Kang YH. Tangeretin Ameliorates Glucose-Induced Podocyte Injury through Blocking Epithelial to Mesenchymal Transition Caused by Oxidative Stress and Hypoxia. Int J Mol Sci 2020; 21: 8577.10.3390/ijms21228577Suche in Google Scholar PubMed PubMed Central
[33] Musah S, Mammoto A, Ferrante TC, Jeanty SSF, Hirano-Kobayashi M, Mammoto T, et al. Mature induced-pluripotent-stem-cell-derived human podocytes reconstitute kidney glomerular-capillary-wall function on a chip. Nat Biomed Eng 2017; 1: 0069.10.1038/s41551-017-0069Suche in Google Scholar PubMed PubMed Central
[34] Rayego-Mateos S, Morgado-Pascual JL, Valdivielso JM, Sanz AB, Bosch-Panadero E, Rodrigues-Díez RR, et al. TRAF3 Modulation: Novel Mechanism for the Anti-inflammatory Effects of the Vitamin D Receptor Agonist Paricalcitol in Renal Disease. J Am Soc Nephrol 2020; 31: 2026–42.10.1681/ASN.2019111206Suche in Google Scholar PubMed PubMed Central
[35] Zhang LN, Kong CF, Zhao D, Cong XL, Wang SS, Ma L, et al. Fusion with mesenchymal stem cells differentially affects tumorigenic and metastatic abilities of lung cancer cells. J Cell Physiol 2019; 234: 3570–82.10.1002/jcp.27011Suche in Google Scholar PubMed
[36] Zou Y, Li L, Li Y, Chen S, Xie X, Jin X, et al. Restoring Cardiac Functions after Myocardial Infarction-Ischemia/Reperfusion via an Exosome Anchoring Conductive Hydrogel. ACS Appl Mater Interfaces 2021; 13: 56892–908.10.1021/acsami.1c16481Suche in Google Scholar PubMed
© 2022 Zhiyuan Wang et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Artikel in diesem Heft
- Perspective
- Podocyte developmental pathways in diabetic nephropathy: A spotlight on Notch signaling
- Review
- TGF-β signaling in diabetic nephropathy: An update
- Original Article
- The role of vitamin D receptor agonist on podocyte injury induced by high glucose
- The application effect of the trans-theoretical model of behavior change in diabetic kidney disease patients treated with maintenance hemodialysis
- Correlation analysis between Tervaert glomerular classification and clinical indicators in patients with type 2 diabetic nephropathy
Artikel in diesem Heft
- Perspective
- Podocyte developmental pathways in diabetic nephropathy: A spotlight on Notch signaling
- Review
- TGF-β signaling in diabetic nephropathy: An update
- Original Article
- The role of vitamin D receptor agonist on podocyte injury induced by high glucose
- The application effect of the trans-theoretical model of behavior change in diabetic kidney disease patients treated with maintenance hemodialysis
- Correlation analysis between Tervaert glomerular classification and clinical indicators in patients with type 2 diabetic nephropathy
