The effect of krill oil on Wnt/β-catenin signaling pathway in acetaminophen-induced acute liver injury in mice

Yaşar Şahin; Alparslan Kadir Devrim; Mehmet Eray Alçığır; Ali Şenol; Hüsamettin Ekici; Tuba Devrim; Mert Sudağıdan; Ebru Yıldırım; Miyase Çınar; Merve Bişkin Türkmen; Seydi Ali Peker

doi:10.1515/tjb-2022-0289

Artikel Open Access

The effect of krill oil on Wnt/β-catenin signaling pathway in acetaminophen-induced acute liver injury in mice

Yaşar Şahin , Alparslan Kadir Devrim , Mehmet Eray Alçığır , Ali Şenol , Hüsamettin Ekici , Tuba Devrim , Mert Sudağıdan , Ebru Yıldırım , Miyase Çınar , Merve Bişkin Türkmen und Seydi Ali Peker

Veröffentlicht/Copyright: 29. Mai 2023

Veröffentlicht von

Veröffentlichen auch Sie bei De Gruyter Brill

Manuskript einreichen Informationen für Autor*innen Erkunden Sie dieses Fachgebiet

Aus der Zeitschrift Turkish Journal of Biochemistry Band 48 Heft 3

Abstract

Objectives

This study investigated the effect of krill oil (KO) on liver damage caused by acetaminophen (APAP).

Methods

In the present study, the control and APAP groups were given distilled water by gavage for 14 days. In addition, the KO and APAP+KO groups were given 500 mg/kg krill oil by gavage for 14 days. At the end of 14 days, 0.9 % sodium chloride solution (saline solution) administration was applied intraperitoneally to the control and KO groups. Meanwhile, 220 mg/kg acetaminophen was administered to the APAP and APAP+KO groups. While some biochemical parameters in plasma were examined, some oxidative stress parameters in plasma and liver tissue were evaluated. Apoptotic and inflammatory responses of some primer sequences determined by quantitative Real-Time PCR (qPCR) in liver tissue. After histopathological examination of liver tissue, immunohistochemical analysis was performed with Wnt inhibitory factor-1 (Wif-1), beta-catenin (β-Catenin), and 8-hydroxy-2′-deoxyguanosine (8-OHdG).

Results

The Wif-1 positivity in hepatocytes increased significantly in the APAP group (5.29 ± 0.71) compared to the control (1.14 ± 0.51), and KO (2.14 ± 0.55) groups (p<0.001). The 8-OHdG positivity in hepatocytes increased significantly in the APAP group (19.57 ± 0.58) compared to the control (0.43 ± 0.20), KO (3.57 ± 0.48), and APAP+KO (4.00 ± 2.53) groups (p<0.001).

Conclusions

As a result, krill oil could be used as a nutritional supplement to protect the liver against acetaminophen-induced liver injury.

Keywords: acetaminophen; acute liver injury; krill oil; oxidative stress; qPCR

Introduction

Acetaminophen is one of the most preferred drugs as an antipyretic and analgesic agent worldwide [1]. Acetaminophen, also known as paracetamol, can cause acute liver damage due to hepatotoxicity due to a conscious or unconscious overdose [2]. In recent years, scientific studies have been carried out on protective substances such as herbal agents against liver damage caused by acetaminophen (paracetamol) [3].

Krill (Euphausia Superba), the tiny marine crustacean, is an essential source of nutrients, which include unsaturated fatty acids (omega-3), vitamins (A and E), minerals, astaxanthin, phospholipids and flavonoids such as eicosapentaenoic (EPA) and docosahexaenoic acid (DHA). The krill oil obtained from this small crustacean can be beneficial in preventing and treating asthma, hypertension, cardiovascular and inflammatory diseases [4, 5].

The liver constitutes several damages related to oxidative stress according to dosage and duration of exposure [6]. In particular, repetitive and high toxic doses excess regenerative capacity and, unfortunately, develop hepatic injuries [7, 8]. In the regeneration process, some growth factors, cytokines, and signaling have a potential role in hepatocyte growth, proliferation, and self-renewal. One of these pathways is the Wnt/β-catenin pathway [9]. Oxidative stress is the deterioration of the reactive oxygen species (ROS)/antioxidant balance due to the increase and/or accumulation of ROS in cells. Due to this increase in ROS, oxidative damage in DNA, proteins and fats and as a result physiological and structural changes in cells occur. In particular, 8-OHdG can be used to determine the oxidative damage of DNA [10].

It may be necessary to use protective agents to help curb side effects due to overdose paracetamol use (patients who will use drugs with obligatory antipyretic and analgesic effects). For this reason, the protective effect of krill oil, which is used as a nutritional supplement, against liver damage caused by acetaminophen (paracetamol) has been investigated.

Materials and methods

Animal experimental protocol

The study was started after the approval of the Kırıkkale University Animal Experiments Ethics Committee (2020-41). 40 Balb/C mice (male, 30 ± 5 g, 6–8 weeks old) were used in the study. The mice were divided into four groups, with 10 mice in each. In the present study, the control and APAP groups were given distilled water by gavage for 14 days. In addition, the KO and APAP+KO groups were given 500 mg/kg krill oil (Krilom^®, Tabilaç, Türkiye) by gavage for 14 days [11]. At the end of 14 days, the control and KO groups were applied intraperitoneally to saline solution. Likewise, at the end of 14 days, the APAP and APAP+KO groups were applied intraperitoneally to 220 mg/kg acetaminophen (Partemol^®, Vem, Turkey). 12 hours after the last intraperitoneal administration, the mice blood (lithium heparin tube) was drawn from vena cava caudalis anaesthesia [90 mg/kg ketamine (Vetaketam^®, Vetagro, Poland), 10 mg/kg xylazine (Xylazinbio 2 %^®, Bioveta, Czech Republic), i.p.] after blood collection, and liver tissue was taken [12].

Biochemical analysis

Blood samples taken from the mice under anaesthesia were centrifuged (1,600 g, 4 °C, 10 min), and their plasma was separated. Plasma aspartate transaminase (AST) and alanine aminotransferase (ALT) enzyme activities, glucose (GLU), total cholesterol (TCHOL), and total protein (TP) levels were determined by a colorimetric method in a spectrophotometer device (Shimadzu, Japan) with the protocol of commercial kits (19205 , 19210, 19200, 19160, and 19265 M kits catalogue numbers, respectively, Diaclinica, Turkey).

The liver tissue was cleaned off the blood and similar residues with distilled water, washed with cold saline solution, and dried with gauze. Before analysis, phosphate buffer (1/10, pH; 7.4) was added to liver tissue (approximately 0.5 g, wet tissue) and divided into small pieces. These pieces were first homogenized (10 s) on ice, kept for 30 s, and then homogenized again using a homogenizer (an ultrasonic, 10 s, five repetitions). Then, these homogenate tubes were centrifuged (10,000 g, 10 min) to obtain supernatants.

Using the method of Buege and Aust [13], malondialdehyde (MDA) levels in tissue supernatant and plasma were determined using a spectrophotometer (Shimadzu, Japan) at a wavelength of 536 nm. This method is based on the principle that thiobarbituric acid and MDA react to form a pink-coloured compound. Using the method of Erel [14], total antioxidant status (TAS) levels in tissue supernatant and plasma were determined in a microplate reader (Thermo Scientific™ Multiskan, UK) using commercial test kits (RL0017, Rel Assay Diagnostics, Turkey). This method is based on reducing the coloured 2,2ʹ-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) radical to a colourless reduced form with the antioxidants in the blood and liver tissue samples.

Quantitative real-time PCR

RNA samples were isolated from liver tissue samples using the total RNA isolation kit (74106, Qiagen, Germany). Total RNA samples were measured at 260 and 280 nm using a nanodrop plate reader (Thermo Scientific Multiskan Go, USA), and concentration and purity values were determined by A ₂₆₀/A ₂₈₀ ratio. The primer sequences are given in Table 1. cDNA samples were synthesized using a kit (#K1682, Thermo Scientific, USA). Each was quantified to 250 ng and used for amplifying the investigated genes using qPCR reactions as previously described [15].

Table 1:

Primer sequences were used in the qPCR analyses.

Gene	Forward (F)/Reverse (R)	Primer sequence (5′–3′)	References
Bcl-2	F	CCTGTGGATGACTGAGTACCTG	[16]
Bcl-2	R	AGCCAGGAGAAATCAAACAGAGG	[16]
Caspase-3	F	CCTCAGAGAGACATTCATGG	[17]
Caspase-3	R	GCAGTAGTCGCCTCTGAAGA	[17]
COX-1	F	CACTGGTGGATGCCTTCTCT	[18]
COX-1	R	CCGTACAGCTCCTCCAACTC	[18]
COX-2	F	CCCTGAAGCCGTACACATCA	[18]
COX-2	R	TGTCACTGTAGAGGGCTTTCAATT	[18]
GAPDH	F	CTGGGATGGAAATTGTGAGG	[19]
GAPDH	R	TGGCCTCCAAGGAGTAAGAA	[19]

Bcl-2, B-cell lymphoma-2; COX-1, cyclooxygenase 1; COX-2, cyclooxygenase 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Histopathological examinations

The liver tissues from mice were treated with graded alcohol, xylol series, and blocked-in paraffin (Leica, Germany). Sections (5 µm) obtained from paraffin blocks were stained according to the hematoxylin-eosin (H&E) method [20]. These sections were evaluated under the microscope (Olympus, Japan), and images were taken.

Immunoperoxidase detection

Streptavidin-biotin complex peroxidase (Strept ABC-P) method was followed on salinized slides according to manual instruction in the peroxidase detection system (Novocastra RE7120-CE, Leica, Germany). Wif-1 (sc373780, Santa Cruz, USA), β-Catenin (sc7963, Santa Cruz, USA) and 8-OHdG (ab62623, Abcam, UK) were used as primary antibiotics. Then, primary antibodies were dripped onto slides and incubated at 37 °C overnight. Phosphate-buffered saline was used in the negative control instead of primary antibodies. As a positive control, cross-reaction was shown using mice tissue. Diaminobenzidine was used as chromogen, and Gill’s hematoxylin was used for the counterstain. All sections were covered with coverslips and a non-aqueous mounting medium (107961, Entellan, Merck, Germany).

Lesion scoring and statistical analysis

Data were given as arithmetic mean ± standard error (SE). Statistical analyses were performed using the SPSS program (PASW Statistics for Windows, ver. 18.0. Chicago, USA). For biochemical findings, One-Way ANOVA was used as the groups showed parametric distribution, and the Duncan test (post hoc) was used to control the significance of the difference between groups (p<0.05).

Since the immunohistochemical findings did not show the parametric distribution in the groups, the Kruskal Wallis test and Mann-Whitney U test (Bonferroni adjustment; p<0.0083) were used to control the significance of the difference between groups. Statistical analyses of qPCR results and graphs were performed using GraphPad Prism (GraphPad Software ver. 8.0, San Diego, CA, USA). Differences in the expression values were evaluated by the One-Way ANOVA and Tukey’s tests. Tukey’s tests (post hoc) were used to control the significance of the difference between groups (p<0.05). The histopathological findings were scored semi-quantitatively from negative to strong counting % calculation from 10 High Power Fields (HPFs). (−): 0–10 %/10 HPFs, (+): mild 10–30 %/10 HPFs, (++): moderate 30–70 %/10 HPFs, (+++): strong>70 %/10 HPFs.

Results

Biochemical parameters

The plasma ALT, AST, GLU, TCHOL and TP results of the study groups are given in Table 2. The ALT enzyme activity of the APAP group was found to be significantly higher than the control, KO, APAP+KO groups (p<0.01). Although the APAP group’s AST, GLU, TCHOL, and TP parameters were higher than those of the control, KO, APAP+KO groups, no statistical significance was found (p>0.05).

Table 2:

Plasma biochemical parameter levels of the study groups.

Groups	ALT, U/L	AST, U/L	GLU, mg/dL	TCHOL, mg/dL	TP, mg/dL
Control	8.32 ± 0.43^a	43.16 ± 2.21	259.70 ± 7.61	194.01 ± 7.50	4.39 ± 0.17
KO	8.27 ± 0.87^a	42.46 ± 1.73	236.88 ± 10.85	188.71 ± 12.73	4.06 ± 0.13
APAP	13.31 ± 1.36^b	47.65 ± 1.23	272.08 ± 9.84	202.58 ± 7.62	4.58 ± 0.14
APAP+KO	9.06 ± 1.52^a	42.86 ± 3.07	258.11 ± 6.19	196.31 ± 3.64	4.14 ± 0.19

^a,bThe difference between values (mean ± SE) with different letters in the same column was statistically significant (^a,bp<0.01). KO group, krill oil group; APAP group, acetaminophen group; APAP+KO, acetaminophen + krill oil group; ALT, alanine aminotransferase; AST, aspartate transaminase; GLU, glucose; TCHOL, total cholesterol; TP, total protein.

Oxidative stress parameters

The plasma and liver tissue oxidative stress parameters of the study groups are given in Table 3. There was no statistical difference in plasma MDA levels among the control, KO, APAP, and APAP+KO groups (p>0.05). Although the TAS (plasma) level was higher in the KO group compared to the other groups, it was not statistically significant (p>0.05). However, there was a statistically significant increase in MDA levels (liver tissue) in the KO, APAP, and APAP+KO groups compared to the control group (p<0.001). In addition, there was an increase in liver tissue TAS levels in the KO, APAP, and APAP+KO groups compared to the control group (p<0.01). Although there was no statistical difference, the liver tissue TAS level of the KO group was numerically higher than the APAP and APAP+KO groups (p>0.05).

Table 3:

The liver tissue and plasma oxidative stress parameters of the control and experimental groups.

Groups	Liver tissue		Plasma
Groups	MDA, µmol/g wet tissue	TAS, µmol/g wet tissue	MDA, µmol/L	TAS, mmol/L
Control	3.21 ± 0.32^b	0.59 ± 0.10^d	1.23 ± 0.03	0.53 ± 0.11
KO	5.40 ± 0.27^a	2.82 ± 0.72^c	1.23 ± 0.02	0.86 ± 0.14
APAP	6.87 ± 0.74^a	1.98 ± 0.27^c	1.26 ± 0.03	0.44 ± 0.11
APAP+KO	6.41 ± 0.61^a	2.59 ± 0.48^c	1.20 ± 0.06	0.43 ± 0.12

^a,bThe difference between values (mean ± SE) with different letters in the same column was statistically significant (^c,dp<0.01, ^a,bp<0.001). KO group: krill oil group; APAP group, acetaminophen group; APAP+KO, acetaminophen + krill oil group; MDA, malondialdehyde; TAS, total antioxidant status.

qPCR

Decreased Bcl-2, increased caspase-3 mRNA expression values in APAP-applied mice and raised COX-1 mRNA levels in KO-applied animals were determined by group means (Figure 1). However, all these alterations did not reveal a statistically significant level (p>0.05). In addition, we could not detect COX-2 expression in studied liver tissues.

Figure 1:

qPCR analysis results of the control, KO, APAP and APAP+KO groups. mRNA levels were normalized to the housekeeping GAPDH. Data are presented as the mean ± standard error (SE). There is no statistically significant difference between the groups (p>0.05). KO group, krill oil group; APAP group, acetaminophen group; APAP+KO, acetaminophen + krill oil group; Bcl-2, B-cell lymphoma-2; COX-1, cyclooxygenase 1.

Histopathological findings

The histopathological findings of the study groups are given in Supplementary Table 1. In the APAP group, degenerative and necrotic results were highly elevated. Hepatocyte cytoplasm contained clear and nonstained vacuoles with a rough edge. In many fields, hepatocyte nuclei were lost. Some of the nuclei were pyknotic and/or lytic in appearance. Such areas were observed at the periphery of necrotic areas, which had lost the liver microarchitecture. Kupffer cell activations were especially dense in such microscopic fields. Many portal and central veins, as well as sinusoids, were enlarged with erythrocytes. In some portal areas and sinusoids, inflammatory cells, including lymphocytes and macrophages, were encountered. In the APAP+KO group, the aforementioned degeneration and necrosis were not distributed at every lobule. In some hepatocytes founding paracentral regions showed cellular alterations. Kupffer cell activations were lower in this group when compared to the previous (APAP) group. Degeneration and necrosis were distinctively low in the KO group, and Kupffer cell activation was lower than in the previous group. A few central veins were hyperemic in some fields. In the control group, degeneration was distinctively low. The histopathological images of the liver tissue of the study groups were given in Figure 2.

Figure 2:

The histopathological images of the liver tissue of experimental groups. Degeneration in hepatocytes (arrows), (A) control group, (B) KO group, (C) APAP group, (D) APAP+KO group, ×400 magnification, H&E staining. KO group, krill oil group; APAP group, acetaminophen group; APAP+KO, acetaminophen + krill oil group.

Presence of immunodetection

The liver tissue immunohistochemical findings of the study groups are given in Supplementary Table 2. The positives were seen as light to dark brown according to the strength of the antigenic reaction. Control group findings regarding Wnt-inhibiting factor, or Wif, were slightly positive in hepatocytes. In Kupffer cells, there were no signals. β-catenin reactions were found slightly. 8-OhdG expressions were found in a few hepatocytes. When compared to control group positivity by these immunomarkers, Wif positivity was slightly increased in some hepatocytes locating paracentral fields of the hepatic lobes of the KO group (p>0.05). However, APAP group wif positivity were increased significantly in hepatocytes (p<0.001). It was more evaded in hepatocytes of the APAP group during whole lobes when compared to hepatocytes in the KO group. In contrast to this finding, APAP-KO findings were not as evident as in that of the APAP group. The positivity was observed in some hepatocytes of hepatic lobes. The positivity was denser in the paracentral fields of the lobes. On the other hand, β-catenin positivity was founded parallel to Wif positivity in the control group and APAP-KO group even though the positive cell numbers were increased in the KO group in terms of β-catenin immunomarker (p>0.05). In the APAP group, β-catenin was decreased in contrast to previous groups (p>0.05). 8-OHdG positivity was found in a couple of cells of control group animals. KO and APAP-KO group findings showed similar reaction numbers with previous immunomarkers in hepatocytes. However, APAP group 8-OHdG positivity was increased significantly in hepatocytes (p<0.001). The immunohistochemical images of the liver tissue of the study groups are given in Figure 3.

Figure 3:

The immunohistochemical images of the liver tissue of experimental groups. Positivities in hepatocytes (arrows), (A) control group, (B) KO group, (C) APAP group, (D) APAP+KO group, 1: 8-OhdG, 2: β-catenin, 3: Wif, ×400 magnification, strept ABC-P staining. KO group, krill oil group; APAP group, acetaminophen group; APAP+KO, acetaminophen + krill oil group; Wif, Wnt inhibitory factor-1; β-catenin, beta-catenin; 8-OhdG, 8-Hydroxy-2′-deoxyguanosine.

Discussion

Side effects of some drugs in treating various diseases can cause serious problems [21]. The use of common and frequently used drugs, such as paracetamol can especially cause different side effects, such as acute liver failure [22]. Therefore, many researchers are investigating the protective effects of drugs to minimize drug-induced side (toxic) effects [12, 23]. Recently, nutritional supplements that are known to have a protective effect against most diseases are commonly used [24].

Many studies have confirmed the relationship of paracetamol-induced acute liver injury (hepatotoxicity) with changes in ALT and AST enzyme activities. They reported an increase in ALT and AST enzyme activity levels due to liver function damage [12, 23]. Similarly, ALT and AST enzyme activity increased after APAP administration in the APAP group compared to the control group.

Here we also aimed to determine the alterations in mRNA expressions of apoptotic and inflammatory genes due to APAP and KO applications in the liver of mice. We determined that while Bcl-2 level decreased in the APAP-administered group, Bcl-2 and COX-1 levels increased in the KO-administered group. However, these alterations did not reach statistically significant levels (p>0.05). In a study investigating the structural effects of APAP on the liver and kidney, Guo et al. [25] reported a reduction in Bcl2 levels in APAP-damaged liver. Additionally, KO application was found to increase Bcl-2 expression in a study investigating the mechanisms of KO application in an Aβ25-35-induced Alzheimer’s disease mice model [10]. The authors suggested that KO might be a potential agent for preventing and treating Alzheimer’s disease. Caspase-3 is an eventual executioner protease in apoptotic cell death [26], and consistent with our results caspase-3 levels were also reported to increase after APAP application in primary cultured mice hepatocytes [27].

Malondialdehyde is a product of lipid peroxidation and causes cellular deterioration as a result of disruption of the structural function of the cellular membrane [28]. Many studies have reported a relationship between oxidative stress and paracetamol-induced hepatotoxicity and an increase in MDA level, indicating lipid peroxidation and liver function deterioration [29, 30]. The study found that the increase in MDA level caused by paracetamol was reduced by dose krill oil. Kim et al. [10] investigated the effects of krill oil against amyloid β-induced Alzheimer’s disease in mice. And they reported that krill oil (500 mg/kg) decreased the MDA level in brain tissue compared to the control group. In the study, it was found that the MDA level increased in the KO (500 mg/kg) group compared to the control group. The reason why the presented study is different from the aforementioned study [10] is thought to be due to the tissue difference. Gokkaya et al. [31], investigated the effects of resveratrol and avocado oil against paracetamol-induced hepatotoxicity in rats. They found that resveratrol and resveratrol+avocado increased the TAS level that paracetamol decreased the liver tissue. Similarly, the present study found that krill oil increased the TAS level while paracetamol decreased in liver tissue. Krill oil contains the powerful natural antioxidant astaxanthin. Studies with astaxanthin have revealed many positive health effects, such as suppression of some types of cancer, protection against free radicals, and prevention of cardiovascular diseases [32, 33]. The study is compatible with the studies above and shows the antioxidant properties of krill oil on liver tissue. The hepatocytes select death under higher oxidative stress, such as higher acetaminophen administration, because they cannot resist or tolerate these catabolites. Thus, degeneration and necrosis are frequently observed due to such kinds of hepatotoxicities [7, 34]. It is reported by Al-Doaiss [35] that hepatocytes of APAP-treated rats showed effects such as degeneration and necrosis. In our study, we found that hepatocytes in the APAP group showed more degenerative and necrotic findings. In many fields, hepatocytes were lost in some areas. Such findings were fewer in the KO and APAP-KO groups. In particular, the decreasing levels of these alternative changes in the last two groups were found to be significant. On one side, the number of Kupffer cell activations was more increased in fields including liver injury in APAP-KO groups. Thus, we believe that there is a capacity for higher compensation for cellular alteration under APAP toxicity.

In the APAP-KO group, both cellular injuries and kupffer cell activation were found to be as low as those of the KO group. On the other side, many portal and central veins, as well as sinusoids, were enlarged with erythrocytes in the APAP group. Blood vessel & sinusoid congestion is related to findings reported by Al-Doaiss [35].

One possible factor has been showing activation of the Wnt/β-catenin pathway in hepatocyte proliferation [9]. In this signaling system, β-catenin is mentioned as a pioneer in the way of providing both regulations of cytochrome P450 and phosphorylation of S45/Thr41 and S33/37/Thr41 sites after overdose acetaminophen administration. The experimental studies noted that the early activation of β-catenin, depending on the dose of APAP (overdose APAP in a day) promotes liver regeneration by promoting the G1/S phase cell cycle transition [36], [37], [38]. So, it is proven that the early selective activation of pioneer β-catenin has produced a proliferation of these cells. This positive stimulation initializes in the frequent pericentral region of hepatic lobes.

As a result of the study, the lack of reactive metabolite formation, Wnt/β-catenin, and also β-catenin activation may affect regeneration in the presence of an APAP overdose [36]. Our study also found higher regeneration, especially in the periphery of the central area of hepatic lobes. These positive stimuli were denser in APAP-KO and KO groups when compared to the overdose APAP group. Regeneration signaling system markers, Wnt and β-catenin, and their levels were found at balance in APAP-KO and KO groups. From another point of view, excessive formation of ROS causes peroxidation in cell membranes, DNA damage, and protein oxidation [39]. As a result of ROS accumulation in these kinds of cells, hydroxyl radicals are over-produced in the nucleus, and this situation can easily modify DNA structure. The 8-OHdG is the most abundant of the oxidized bases and is utilized for showing DNA oxidation [40]. In our study, 8-OHdG, which is known as this oxidative stress marker of DNA, was found at lower levels in the APAP-KO and KO groups. In contrast to this, pioneer β-catenin signals were found lower in the overdose of the APAP group than in others. When compared to previous immunomarkers, this elevated 8-OHdG positivity was discussed as a prominent sign in the way of degeneration and necrosis in the APAP group. However, other group findings were significantly decreased when compared to the APAP group. Another concrete result in the way of support of krill oil success is Wnt and β-catenin signals. In our study, Wnt inhibition expressions were elevated in the APAP group; however, the expressions were decreased in other groups, including krill oil, apart from controls. β-catenin signals were getting by this Wnt inhibition levels in krill oil, including groups. Hence, we believe that krill oil additive groups provide low oxidative stress for cells, which will help ensure their survival. The results of this study show that krill oil can even trigger cellular regeneration by blocking cellular debris.

In conclusion, krill oil may increase antioxidant status (i.e. TAS) in the microenvironment against paracetamol toxicity. Because cellular catabolism has been stopped by krill oil, cellular functions such as enzymes and molecular pathways have run within normal limits. In particular, Wnt-beta catenin signaling interactions in preserving cellular homeostasis bears a key point after krill oil administration. For this reason, krill oil can be used as a nutritional supplement to protect against liver damage caused by paracetamol (as a result of any health problem). In addition, due to the protective effect of krill oil against liver damage, new studies can be conducted at different doses.

Corresponding author: Yaşar Şahin, Department of Pharmacology and Toxicology, Faculty of Veterinary Medicine, Kırıkkale University, Kırıkkale, Türkiye, E-mail: yasarsahin07@gmail.com

Research funding: None declared.
Author contributions: All authors have accepted responsibility for the entire content of this manuscript and approved its submission.
Competing interests: Authors state no conflict of interest.
Informed consent: Informed consent was obtained from all individuals included in this study.
Ethical approval: The study was started after the approval of the Kırıkkale University Animal Experiments Ethics Committee (2020-41).

References

1. Larson, AM. Acetaminophen hepatotoxicity. Clin Liver Dis 2007;11:525–48. https://doi.org/10.1016/j.cld.2007.06.006.Suche in Google Scholar PubMed

2. Chun, LJ, Tong, MJ, Busuttil, RW, Hiatt, JR. Acetaminophen hepatotoxicity and acute liver failure. J Clin Gastroenterol 2009;43:342–9. https://doi.org/10.1097/mcg.0b013e31818a3854.Suche in Google Scholar

3. Du, K, Ramachandran, A, Jaeschke, H. Oxidative stress during acetaminophen hepatotoxicity: sources, pathophysiological role and therapeutic potential. Redox Biol 2016;10:148–56. https://doi.org/10.1016/j.redox.2016.10.001.Suche in Google Scholar PubMed PubMed Central

4. Colletti, A, Cravotto, G, Citi, V, Martelli, A, Testai, L, Cicero, AFG. Advances in technologies for highly active omega-3 fatty acids from krill oil: clinical applications. Mar Drugs 2021;19:306. https://doi.org/10.3390/md19060306.Suche in Google Scholar PubMed PubMed Central

5. ŞÇelebi, Kaya, H, Kaya, A. Effects of omega-3 fatty acids on human health. Alınteri J Agric Sci 2017;32:105–12.10.28955/alinterizbd.319437Suche in Google Scholar

6. Birben, E, Sahiner, UM, Sackesen, C, Erzurum, S, Kalayci, O. Oxidative stress and antioxidant defense. World Allergy Organ J 2012;5:9–19. https://doi.org/10.1097/wox.0b013e3182439613.Suche in Google Scholar PubMed PubMed Central

7. Shankar, K, Vaidya, VS, Apte, UM, Manautou, JE, Ronis, MJ, Bucci, TJ, et al.. Type 1 diabetic mice are protected from acetaminophen hepatotoxicity. Toxicol Sci 2003;73:220–34. https://doi.org/10.1093/toxsci/kfg059.Suche in Google Scholar PubMed

8. Mehendale, HM. Tissue repair: an important determinant of final outcome of toxicant-induced injury. Toxicol Pathol 2005;33:41–51. https://doi.org/10.1080/01926230590881808.Suche in Google Scholar PubMed

9. Thompson, MD, Monga, SP. WNT/beta-catenin signaling in liver health and disease. Hepatology 2007;45:1298–305. https://doi.org/10.1002/hep.21651.Suche in Google Scholar PubMed

10. Graille, M, Wild, P, Sauvain, JJ, Hemmendinger, M, Guseva Canu, I, Hopf, NB. Urinary 8-OHdG as a biomarker for oxidative stress: a systematic literature review and meta-analysis. Int J Mol Sci 2020;21:3743. https://doi.org/10.3390/ijms21113743.Suche in Google Scholar PubMed PubMed Central

11. Kim, JH, Meng, HW, He, MT, Choi, JM, Lee, D, Cho, EJ. Krill oil attenuates cognitive impairment by the regulation of oxidative stress and neuronal apoptosis in an amyloid β-induced alzheimer’s disease mouse model. Molecules 2020;25:3942. https://doi.org/10.3390/molecules25173942.Suche in Google Scholar PubMed PubMed Central

12. Liu, J, Luo, D, Wu, Y, Gao, C, Lin, G, Chen, J, et al.. The protective effect of sonneratia apetala fruit extract on acetaminophen-induced liver injury in mice. Evid Based Complement Altern Med 2019;2019:6919834. https://doi.org/10.1155/2019/6919834.Suche in Google Scholar PubMed PubMed Central

13. Buege, JA, Aust, SD. Microsomal lipid peroxidation. Methods Enzymol 1978;52:302–10. https://doi.org/10.1016/s0076-6879(78)52032-6.Suche in Google Scholar PubMed

14. Erel, O. A new automated colorimetric method for measuring total oxidant status. Clin Biochem 2005;38:1103–11. https://doi.org/10.1016/j.clinbiochem.2005.08.00.Suche in Google Scholar

15. Devrim, T, Ataç, F, Devrim, AK, Balcı, M. The concomitant use of USP28 and p53 to predict the progression of urothelial carcinoma of the bladder. Pathol Res Pract 2020;216:152774. https://doi.org/10.1016/j.prp.2019.152774.Suche in Google Scholar PubMed

16. Shen, Y, Shen, X, Cheng, Y, Liu, Y. Myricitrin pretreatment ameliorates mouse liver ischemia reperfusion injury. Int Immunopharmacol 2020;89:107005. https://doi.org/10.1016/j.intimp.2020.107005.Suche in Google Scholar PubMed

17. Spitzer, AJ, Tian, Q, Choudhary, RK, Zhao, FQ. Bacterial endotoxin induces oxidative stress and reduces milk protein expression and hypoxia in the mouse mammary gland. Oxid Med Cell Longev 2020;2020:3894309. https://doi.org/10.1155/2020/3894309.Suche in Google Scholar PubMed PubMed Central

18. Ge, Y, Strait, KA, Stricklett, PK, Yang, T, Kohan, DE, 2007. Role of prostaglandins in collecting duct-derived endothelin-1 regulation of blood pressure and water excretion. Am J Physiol Renal Physiol 2007;293:1805–10. https://doi.org/10.1152/ajprenal.00307.2007.Suche in Google Scholar PubMed

19. Sonobe, A, Jesmin, S, Shimojo, N, Islam, M, Khantun, T, Oki, M, et al.. Concomitant down-regulation of Et1-Etb system and vegf angiogenic signaling in the frontal cortex of endotoximic mice: a heightened vulnerability to cerebral microcirculation in sepsis. J Vasc Med Surg 2015;3:206.Suche in Google Scholar

20. Luna, LG. Manual of histologic staining methods of the armed forces ınstitute of pathology, 3rd ed. New York: McGraw-Hill; 1968.Suche in Google Scholar

21. Triantafyllou, K, Vlachogiannakos, J, Ladas, SD. Gastrointestinal and liver side effects of drugs in elderly patients. Best Pract Res Clin Gastroenterol 2010;24:203–15. https://doi.org/10.1016/j.bpg.2010.02.004.Suche in Google Scholar PubMed

22. Fisher, ES, Curry, SC. Evaluation and treatment of acetaminophen toxicity. Adv Pharmacol 2019;85:263–72. https://doi.org/10.1016/bs.apha.2018.12.004.Suche in Google Scholar PubMed

23. Lin, G, Luo, D, Liu, J, Wu, X, Chen, J, Huang, Q, et al.. Hepatoprotective effect of polysaccharides isolated from dendrobium officinale against acetaminophen-induced liver injury in mice via regulation of the Nrf2-Keap1 signaling pathway. Oxid Med Cell Longev 2018;2018:6962439. https://doi.org/10.1155/2018/6962439.Suche in Google Scholar PubMed PubMed Central

24. Halsted, CH. Dietary supplements and functional foods: 2 sides of a coin? Am J Clin Nutr 2003;77:1001–7. https://doi.org/10.1093/ajcn/77.4.1001S.Suche in Google Scholar PubMed

25. Guo, C, Xie, G, Su, M, Wu, X, Lu, X, Wu, K, et al.. Characterization of acetaminophen-induced cytotoxicity in target tissues. Am J Transl Res 2016;8:4440–5.Suche in Google Scholar

26. Owumi, SE, Aliyu-Banjo, NO, Danso, OF. Fluoride and diethylnitrosamine coexposure enhances oxido-inflammatory responses and caspase-3 activation in liver and kidney of adult rats. J Biochem Mol Toxicol 2019;33:e22327. https://doi.org/10.1002/jbt.22327.Suche in Google Scholar PubMed

27. Kon, K, Ikejima, K, Okumura, K, Aoyama, T, Arai, K, Takei, Y, et al.. Role of apoptosis in acetaminophen hepatotoxicity. J Gastroenterol Hepatol 2007;22:49–52. https://doi.org/10.1111/j.1440-1746.2007.04962.x.Suche in Google Scholar PubMed

28. Klaunig, JE, Xu, Y, Isenberg, JS, Bachowski, S, Kolaja, KL, Stevenson, DE, et al.. The role of oxidative stress in chemical carcinogenesis. Environ Health Perspect 1998;106:289–95. https://doi.org/10.1289/ehp.98106s1289.Suche in Google Scholar PubMed PubMed Central

29. Rašković, A, Gigov, S, Čapo, I, Kusturica, MP, Milijašević, B, Kojić-Damjanov, S, et al.. Antioxidative and protective actions of apigenin in a paracetamol-induced hepatotoxicity rat model. Eur J Drug Metab Pharmacokinet 2017;42:849–56.10.1007/s13318-017-0407-0Suche in Google Scholar PubMed

30. Bhatt, S, Sharma, A, Dogra, A, Sharma, P, Kumar, A, Kotwal, P, et al.. Glabridin attenuates paracetamol-induced liver injury in mice via CYP2E1-mediated inhibition of oxidative stress. Drug Chem Toxicol 2022;45:2352–60. https://doi.org/10.1080/01480545.2021.1945004.Suche in Google Scholar PubMed

31. Gokkaya, EO, Yesilot, S, Ozgocmen, M, Aslankoc, R, Aydin Acar, C. Protective effects of resveratrol and avocado oil against paracetamol-induced hepatotoxicity in rats. Drug Chem Toxicol 2022;45:2131–9. https://doi.org/10.1080/01480545.2021.1908716.Suche in Google Scholar PubMed

32. Pashkow, FJ, Watumull, DG, Campbell, CL. Astaxanthin: a novel potential treatment for oxidative stress and inflammation in cardiovascular disease. Am J Cardiol 2008;101:58–68. https://doi.org/10.1016/j.amjcard.2008.02.010.Suche in Google Scholar PubMed

33. Tripathi, DN, Jena, GB. Astaxanthin intervention ameliorates cyclophosphamide-induced oxidative stress, DNA damage and early hepatocarcinogenesis in rat: role of Nrf2, p53, p38 and phase-II enzymes. Mutat Res 2010;696:69–80. https://doi.org/10.1016/j.mrgentox.2009.12.014.Suche in Google Scholar PubMed

34. Apte, UM, Limaye, PB, Ramaiah, SK, Vaidya, VS, Bucci, TJ, Warbritton, A, et al.. Upregulated promitogenic signaling via cytokines and growth factors: potential mechanism of robust liver tissue repair in calorie-restricted rats upon toxic challenge. Toxicol Sci 2002;69:448–59. https://doi.org/10.1093/toxsci/69.2.448.Suche in Google Scholar PubMed

35. Al-Doaiss, AA. Hepatotoxicity-induced by the therapeutic dose of acetaminophen and the ameliorative effect of oral co-administration of selenium/tribulus terrestris extract in rats. Int J Morphol 2020;38:1444–54. https://doi.org/10.4067/s0717-95022020000501444.Suche in Google Scholar

36. Sekine, S, Lan, BY, Bedolli, M, Feng, S, Hebrok, M. Liver-specific loss of beta-catenin blocks glutamine synthesis pathway activity and cytochrome p450 expression in mice. Hepatology 2006;43:817–25. https://doi.org/10.1002/hep.21131.Suche in Google Scholar PubMed

37. Apte, U, Singh, S, Zeng, G, Cieply, B, Virji, MA, Wu, T, et al.. Beta-catenin activation promotes liver regeneration after acetaminophen-induced injury. Am J Pathol 2009;175:1056–65. https://doi.org/10.2353/ajpath.2009.080976.Suche in Google Scholar PubMed PubMed Central

38. Dadhania, VP, Bhushan, B, Apte, U, Mehendale, HM. Wnt/β-catenin signaling drives thioacetamide-mediated heteroprotection against acetaminophen-induced lethal liver injury. Dose Response 2017;15:1559325817690287.https://doi.org/10.1177/1559325817690287.Suche in Google Scholar PubMed PubMed Central

39. Manoharan, S, Guillemin, GJ, Abiramasundari, RS, Essa, MM, Akbar, M, Akbar, MD. The role of reactive oxygen species in the pathogenesis of alzheimer’s disease, Parkinson’s disease, and huntington’s disease: a mini review. Oxid Med Cell Longev 2016;2016:8590578.https://doi.org/10.1155/2016/8590578 Suche in Google Scholar PubMed PubMed Central

40. Halliwell, B. Role of free radicals in the neurodegenerative diseases: therapeutic implications for antioxidant treatment. Drugs Aging 2001;18:685–716. https://doi.org/10.2165/00002512-200118090-00004.Suche in Google Scholar PubMed

Supplementary Material

This article contains supplementary material (https://doi.org/10.1515/tjb-2022-0376).

Received: 2022-12-26

Accepted: 2023-05-09

Published Online: 2023-05-29

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

https://doi.org/10.1515/tjb-2022-0289

Schlagwörter für diesen Artikel

acetaminophen; acute liver injury; krill oil; oxidative stress; qPCR

Creative Commons

BY 4.0

The effect of krill oil on Wnt/β-catenin signaling pathway in acetaminophen-induced acute liver injury in mice

Artikel

Abstract

Objectives

Methods

Results

Conclusions

Introduction

Materials and methods

Animal experimental protocol

Biochemical analysis

Quantitative real-time PCR

Histopathological examinations

Immunoperoxidase detection

Lesion scoring and statistical analysis

Results

Biochemical parameters

Oxidative stress parameters

qPCR

Histopathological findings

Presence of immunodetection

Discussion

References

Supplementary Material

Zusatzmaterial

Artikel in diesem Heft

Artikel in diesem Heft

Artikel in diesem Heft