Home Medicine PIK3CA and TP53 MUTATIONS and SALL4, PTEN and PIK3R1 GENE EXPRESSION LEVELS in BREAST CANCER
Article Publicly Available

PIK3CA and TP53 MUTATIONS and SALL4, PTEN and PIK3R1 GENE EXPRESSION LEVELS in BREAST CANCER

  • Ebubekir Dirican ORCID logo , İpek Erbarut Seven , Handan Kaya , M. Ümit Uğurlu , İrem Peker , Bahadır M. Güllüoğlu , Ayşe Özer and Mustafa Akkiprik EMAIL logo
Published/Copyright: March 2, 2020
Download Article (PDF)
Turkish Journal of Biochemistry
From the journal Turkish Journal of Biochemistry Volume 45 Issue 5

Abstract

Objective

A high frequency of PI3K signalling pathway abnormalities and TP53 mutations are critical in the development and progression of breast cancer (BCa). We aimed to detect PIK3CA and TP53 mutations via an expression analysis of PIK3R1, PTEN and SALL4 and correlate the expression of these genes with clinical parameters of BCa.

Materials and methods

PIK3CA and TP53 mutations in BCa samples were analysed by High-Resolution Melting (HRM) analysis, followed by Sanger sequencing, and the expression levels of PIK3R1, PTEN and SALL4 were evaluated by RT-PCR methods.

Results

The frequency of PIK3CA and TP53 mutations was 42% and 38% according to the HRM and Sanger sequencing. There was a significantly high frequency of these mutations in ER( +), N0 and HER2( −) tumour samples. PIK3R1 and PTEN expression levels were high in tumour samples, whereas SALL4 expression was low. In patients with TP53 mutations, PIK3R1 expression was low, and this finding was statistically significant. PIK3R1 and PTEN expression levels showed statistically significant, respectively in G3 grades, ER(+), (PR)( +), HER2(+) and ER( +).

Conclusions

We suggest that these candidate genes could be potential prognostic biomarkers of BCa and that they should be considered in the evaluation of clinical parameters of BCa.

Öz

Amaç

Yüksek frekanstaki PI3K sinyal yolağı anormallikleri ve TP53 mutasyonları, meme kanseri gelişimi ve ilerlemesinde kritik öneme sahiptir. Bu çalışmanın amacı PIK3CA ve TP53 mutasyonları ile PIK3R1, PTEN ve SALL4 ekspresyon analizi ve bunların meme kanser klinik parametreleri ile ilişkisini belirlemektir.

Gereç ve Yöntem

Meme kanser örneklerinde Yüksek Çözünürlüklü Erime (HRM) analizi ile PIK3CA ve TP53 mutasyonları analiz, Sanger dizi takibi ve PIK3R1, PTEN ve SALL4 ekspresyon seviyeleri RT-PZR yöntemiyle değerlendirildi.

Sonuçlar

HRM analizi ve dizilemeyle, PIK3CA ve TP53 mutasyon frekansı %42 ve %38 olarak bulundu. Bu mutasyonlar sırasıyla ER( +), N0 ve HER2( −) tümör örneklerinde yüksek ve istatiksel olarak anlamlı görülmüştür. SALL4 ekspresyonu tümör örneklerinde düşük olmasına karşın, PIK3R1 ve PTEN ekspresyon seviyeleri yüksekti. TP53 mutasyonu taşıyan hastalarda PIK3R1 ekspresyonu düşük ve istatiksel olarak anlamlı bulundu. PIK3R1 ve PTEN ekspresyon seviyeleri sırasıyla G3 dereceli, ÖR( +), PR( +), HER2( +) ve ÖR( +)’lerde istatiksel olarak anlamlı olduğu gösterildi.

Sonuç

Biz bu aday genlerin meme kanserinde prognoztik biyo-belirteç olma potansiyellerinin olabileceğini ve böylece bunların meme kanserinde klinik parametrelerin değerlendirilmesinde dikkat edilmesi gerektiğini ileri sürüyoruz.

Keywords: Breast cancer; PI3K; PIK3CA; HRM; Candidate genes
Anahtar Kelimeler: Meme kanser; PI3K; PIK3CA; HRM; aday genler

Introduction

Breast cancer (BCa) is one of the most common diseases in women, affecting 1.3 million women worldwide each year [1], [2]. Several studies revealed mutations and abnormal expression of a number of genes (e.g. BRCA1/2, PIK3CA, TP53, PTEN and CDH1) that are known to play a key role in genomic stability and cancer signalling pathways, including BCa. Research demonstrated that abnormal expression of some of these genes contributed to proliferation, invasion, recurrence and tumour formation (metastasis) in BCa [3]. Detection of genetic aberrations involved in BCa development could provide a theoretical basis for BCa prevention, diagnosis, prognosis and therapy.

Aberrations in the PI3K pathway are among the most common genomic abnormalities in BCa [4]. PI3Ks are essential molecules in this cascade and ultimately cause to tumour cell growth [5]. They are heterodimers comprised of regulatory (p85) and catalytic (p110) subunits that consist of α, β, δ, and γ isoforms [6]. The most common alterations in BCa are PIK3CA (p110α) mutations in the PI3K pathway and the TP53 gene, with alterations in these genes affecting about 27% of BCa patients [7]. The PI3K pathway, which includes the PI3K regulatory PIK3R1 and PTEN, is the most frequently altered pathway in cancer. Spalt-like transcription factor 4 (SALL4) have also crucial role in the proliferation of cancerous cells [8].

In the present study, we investigated how activating mutations in PIK3CA (p110α) and TP53 and the gene expression profile of regulatory subunits PIK3R1 (p85α), PTEN and SALL4 mediated PI3K activation in BCa. The aim of the current study was to detect PIK3CA and TP53 gene mutations, together with SALL4, PTEN and PIK3R1 gene expression levels, and then find the association of the obtained results with BCa clinical parameters. The findings may shed light not only on the association of these mutations and gene expression profiles with BCa progression and development but also on potential prognostic biomarkers of BCa.

Materials and methods

Patients, samples and histopathological evaluation

BCa tissues were obtained from 145 Turkish patients who underwent surgery in the Marmara University School of Medicine during 2010 and 2012 (n=66) and 2016 and 2017 (n=79). The clinical characteristics of the patients are summarized in Supplement Tables 2 and 3. The histological diagnosis was confirmed by a pathologist. The histopathological evaluation criteria have been described in our previous study [9]. Also, for describing BCa subtypes we used the St. Gallen classification system [10].

Our current research was admitted by the research and ethics commission of Marmara University of Medical Sciences.

DNA extraction

After tissue homogenization, genomic DNA was isolated from frozen tissue (−80°C) using a HP- PCR Template Preparation Kit (Roche, Germany), with regard to the kit’s instructions. The concentrations were detected by spectrophotometry and stored at −20°C until used.

PIK3R1, PTEN and SALL4 gene expression analysis

After tissue homogenization, total RNA was isolated from frozen tissue (−80°C) using a HP RNA Tissue Kit (Roche), with regard to the kit’s instructions. The total RNA concentration was detected by spectrophotometry. After evaluating the concentration and purity of total RNA using a spectrophotometer, the total RNA was reverse transcribed.

PIK3R1, PTEN and SALL4 transcription were quantified by RT-PCR using LightCycler® 480 Probes Master (Roche) according to the manufacturer’s protocol. RT-PCR and 5 μL of cDNA were used in a reaction volume of 20 μL (4 μL of dH2O, 10 μL).

LC® 480 Probes master (2X), 1 μL of Real-Time ready Assay (20X) with each sample analysed in duplicate. The beta-actin reference gene was used as an internal control to normalize variability in expression levels. The primer probe mix for each gene was purchased as a Real-Time Ready Custom Single Assay (Roche) and used with regard to the kit’s instructions.

HRM analysis

The HRM assay and analysis protocol were described in our previous study (Dirican et al. 2014). HRM was accomplished using the LightCycler® 480 (Roche) platform and an LC480 HRM Master Mix reagent kit (Roche), with 5 μL of gDNA and 0.4 μL of each primer in a final volume of 20 μL, in accordance with the manufacturer’s instructions. Primers for PIK3CA (exons 9 and 20) and TP53 (exons 5–8) genes (Table 1) were used as described previously [11], [12], and samples with a shift in the HRM analysis and melting temperature curves were then sequenced. The cycling conditions were 95°C (10 min), 45 cycles of 60°C (20 sec), 72°C (25 sec), 95°C (5 sec) and a final extension at 40°C for 10 min.

Table 1:

Primer pairs used for HRM assay and Sanger Sequencing.

Primer Sequence (5′-->3′)
PIK3CA sequencing
 exon 9-F TGAAAATGTATTTGCTTTTTCTGT
 exon 9-R TGTAAATTCTGCTTTATTTATTCC
 exon 20-FTTTGCTCCAAACTGACCAA
 exon 20-RGCATGCTGTTTAATTGTGTGG
PIK3CA HRM
 exon 9-FPTGACAAAGAACAGCTCAAAGCAA
 exon 9-RP TTTTAGCACTTACCTGTGACTCCA
 exon 20-FP GCAAGAGGCTTTGGAGTATTTCA
 exon 20-RPATGCTGTTTAATTGTGTGGAAGATC
TP53 HRM and sequencing
 exon 5-FP TGTTCACTTGTGCCCTGACT
 exon 5-RPCAGCCCTGTCGTCTCTCCAG
 exon 6-FPGCCTCTGATTCCTCACTGAT
 exon 6-RPTTAACCCCTCCTCCCAGAGA
 exon 7-FPACTGGCCTCATCTTGGGCCT
 exon 7-RPTGTGCAGGGTGGCAAGTGGC
 exon 8-FPTAAATGGGACAGGTAGGACC
 exon 8-RPTCCACCGCTTCTTGTCCTGC

The data were analysed using LightCycler® 480 (Roche) software. The melting curves were normalised and temperature shifted to allow the samples to be directly compared.

Sanger sequencing

Following HRM screening, for the purification of PCR products used an ExoSAP Purification kit, and DNA sequencing was performed with an ABI3500 (Applied Biosciences) sequencer. Then, 2 μL of PCR product was treated with 1 μL of ExoSAP reagent. The treatment was carried out at 37°C for 30 min, followed by an incubation period at 80°C for 1 min to irreversibly inactivate both enzymes. The BigDye v3.1 Sequencing Kit provides a streamlined workflow by eliminating the PCR clean-up step and improving resolution of sequencing data at the 5´ end. PCR sequencing was then performed using 10 μL of PCR products. PCR sequencing was performed using the BigDye v3.1 kit under the following conditions: 96°C for 1 min, followed by 25 cycles each at 96°C for 10 sec, 50°C for 5 sec and 60°C for 4 min, followed by cooling at 4°C. Subsequently, 10 μL of PCR sequencing products were precipitated using 3 μL of ethanol/EDTA, together with sodium acetate, followed by centrifugation to remove excess ethanol. After air drying, the DNA products were solved in 10 μL of dH2O at 95°C for 3 min in a thermal cycler.

Statistical analyses

All tests were performed using Graphpad Instat and SPSS.16.0 (SPSS Inc., Chicago, IL, USA). The correlations of PIK3CA and TP53 gene mutations with clinical parameters and demographic data were evaluated using Fisher’s exact test. The x2 test was used to detect trends. Gene expression was analysed by comparing relative expression using the ∆∆Ct method. A nonparametric test (Mann–Whitney U test) was used to compare groups for categorical variables. Median (interquartile range) values are presented for variables. A p value of 0.05 or less was approved as statistically significant.

Results

PIK3CA gene mutation frequency in BCa tissues

Table 2 shows the results of the HRM analysis of PIK3CA mutations in the BCa samples (n=79) obtained between 2016 and 2017. The HRM assay was used to distinguish wild-type/mutation BCa samples. Supplement Figure 1A shows the results of the HRM assay for PIK3CA exon 9, and Supplement Figure 1B presents the findings for PIK3CA exon 20. The difference in the melting behaviour of heterozygous mutations was due to heteroduplex formation. Heteroduplexes melted earlier and therefore peaked above the wild-type baseline. HRM mutation-positive samples (n=37) were identified by Sanger sequencing. In total, 33 mutations were detected in 79 BCa samples. According to the results, 21 of 33 mutations were in exon 20, and 12 mutations were in exon 9. The exon 20 and exon 9 mutations were identified as H1047L, H1047R, Q546R, E545K and E542K by Sanger sequencing (Figure 1 and Table 2).

Table 2:

PIK3CA mutation frequencies in breast cancer tissues.

ExonNucleotideCodonDomainn (%)
9G1624AE542KHelical4 (5.06)
9G1633AE545KHelical7 (8.9)
9A1637GQ546RHelical1 (1.3)
20A3140GH1047RKinase17 (21)
20A3140TH1047LKinase4 (5.06)
The total number of mutations identified33
The total number of the patients carrying the mutation33
The number of samples examined79
Percentage of samples with the mutation%42
Figure 1: Sequence variants detected in PIK3CA mutations in BCa.(A) An E542K in exon 9 (B) An E545K in exon 9 (C) A Q546R in exon 9 (D) A H1047R in exon 20 (E) A H1047L in exon 20.
Figure 1:

Sequence variants detected in PIK3CA mutations in BCa.

(A) An E542K in exon 9 (B) An E545K in exon 9 (C) A Q546R in exon 9 (D) A H1047R in exon 20 (E) A H1047L in exon 20.

TP53 gene mutation frequency in BCa tissues

Direct Sanger sequencing was used to confirm possible mutations in the samples (n=108). The results of the HRM assay for tumour DNA are shown in Supplement Figure 1C–F and for TP53 exons 5–8. Supplement Table 1 presents the results of the analysis of exons 5–8 in 145 BCa tumours. In total, 67 (38%) mutations were identified in the BCa samples. Seven of these mutations were in exon 5, eight mutations were in exon 6, 21 mutations were in exon 7, and 31 mutations were in exon 8. The mutations in exons 5–8 were identified as R275H, S166, Y163C, R213R, V217A, H214R, R209T, M243T, T256T, G245S, R248Q, G245G, E298K, R290H, H296R, R273H, C275R, E270C, P301P and E294D by Sanger sequencing (Figure 2).

Figure 2: Sequence variants detected in TP53 mutations in BCa.(A) A R175H in exon 5 (B) A S166 in exon 5 (C) A Y163C in exon 5 (D) A R213R in exon 6 (E) A V217A in exon 6 (F) A H214R in exon 6.
Figure 2:

Sequence variants detected in TP53 mutations in BCa.

(A) A R175H in exon 5 (B) A S166 in exon 5 (C) A Y163C in exon 5 (D) A R213R in exon 6 (E) A V217A in exon 6 (F) A H214R in exon 6.

Correlation between PIK3CA mutation status and clinicopathological characteristics

The frequency of PIK3CA exon 9 mutations was significantly high in patients older than 50 y (p=0.0095). Moreover, the ER status exhibited a significant correlation with a higher frequency of PIK3CA exon 9 (p=0.0429) and 20 mutations (p=0.0420). BCa subtypes (e.g. luminal A/B, basal and HER2) were not significantly correlated with the PIK3CA mutation frequency (Supplement Table 2).

Correlation between TP53 mutation status and clinicopathological characteristics

Nod, ER and PR status exhibited a significant correlation with TP53 mutations (p=0.029, p=0.03 and p=0.02, respectively). In terms of clinical profiles, BCa subtypes (luminal A, luminal B, luminal-HER2 and basal type) and age (p>0.05) were not significantly correlated with an increased frequency of TP53 mutations (Supplement Table 3).

Expression of PIK3R1, PTEN and SALL4 mRNA in BCa tumour and non-tumour tissues

PIK3R1, PTEN and SALL4 mRNA were analysed in 112 BCa samples. PIK3R1 and PTEN gene expression levels were higher in tumour tissue than in non-tumour tissue (p<0.0001 and p=0.0059, respectively). On the contrary, the SALL4 gene level was lower in tumours than in non-tumour tissue (p=0.0378) (Supplement Figure 2A–C).

Correlation between PIK3CA mutations and the genes expression status

PIK3R1, PTEN and SALL4 gene expression levels in patients with PIK3CA mutations were higher than those in patients without PIK3CA mutations, with a statistically significant difference (p=0.1561, p=0.7119 and p=0.1684, respectively) (Supplement Figure 3A–C).

Correlation between TP53 mutations and the genes expression status

In patients with TP53 mutations, the PIK3R1 gene expression level was significantly lower than that in patients who did not carry TP53 mutations (p=0.0169). However, PTEN and SALL4 gene expression levels in patients with TP53 mutations were lower than those in patients without TP53 mutations, although this finding was not statistically significant (Supplement Figure 4A–C).

Correlation between the gene expression status and clinicopathological characteristics

The median of gene expression was determined. Gene expression higher than the median value was considered high expression, whereas gene expression below the median value was considered low expression. High expression of PIK3R1, PTEN and SALL4 was detected in 47.7%, 52.4% and 51.7% of BCa samples, respectively. PIK3R1 expression levels exhibited a significant correlation with the histological grade (G3), ER(+), PR(+) and HER2(−) tumours (p<0.05). The PTEN expression level was significantly correlated with ER status (p<0.05). However, SALL4 expression was not significantly correlated with clinical parameters (p>0.05) (Supplement Table 4 and 6).

Discussion

In this study, PIK3CA and TP53 gene mutations were analysed using an HRM assay, and PIK3R1, PTEN and SALL4 gene expression analyses were performed using the RT-PCR. This study aimed to investigate whether these genes could be used as prognostic biomarkers in the diagnosis of BCa. To date, several mutations and gene expression analysis studies have proposed various candidate genes to use as biomarkers in BCa prognosis. However, as most of these gene variation studies were based on non-cancerous tissues, their results have limited clinical value. Therefore, in the present study, PIK3CA and TP53 mutations and PIK3R1, PTEN and SALL4 mRNA expression levels were analysed in cancerous and healthy fresh tissues.

Many studies have reported a high frequency of PIK3CA and TP53 mutations in BCa and demonstrated the important role of these mutations in tumorigenesis. According to the COSMIC [7] report, the mutation frequency of both PIK3CA and TP53 was about 27%. In this study, the results of the HRM assay of PIK3CA and TP53 mutations were confirmed by Sanger sequencing. The frequency of PIK3CA and TP53 mutations was 42% (33/79) and 38% (55/145), respectively. In a previous study, we analysed 101 BCa samples and detected 31 PIK3CA mutations using a HRM assay [9]. As most PIK3CA mutations have been found in exon 9 and exon 20, in current study we analysed PIK3CA exon 9 and exon 20 gene regions and found that mutations were localized in 36% (12/33) of cases in exon 9 and in 64% (21/33) of cases in exon 20. On the other hand, 67 TP53 gene mutations were localized in exons 5–8 sequence regions. The distribution of these 67 mutations in these regions was as follows: 4.8% (7/61) in exon 5, 5.5% (8/61) in exon 6, 14% (20/145) in exon 7 and 18% (26/145) in exon 8. In a study that included 309 BCa patients, Shimoi et al. [13] reported a frequency of PIK3CA mutations of 33% in all subtypes and a frequency of approximately 30–40% in all subtypes. However, they found no statistically significant difference in the mutation frequency in the different subtypes among the 309 BCa samples. Takeshita et al. [14] detected PIK3CA exon 9 and exon 20 mutations in plasma cfDNA in three and seven of 33 patients, respectively. Chen et al. [15] found a somatic mutation in PIK3CA in 44% of Chinese BCa patients. In their study, PIK3CA (32%) and TP53 (29%) genes were the most common mutations in HR(+) BCa patients. In another study, TP53 mutations were related with shorter recurrence-free survival, progression-free survival and overall survival [16]. Although the incidence of PIK3CA mutations in the present study was significantly high in ER(+) patients, no valuable statistical results in terms of the mutation frequency was found in luminal A, invasive ductal carcinoma, T2 tumour stage, G2 histological grade, nod 0, aged >50 y, PR(+), HER2(−) and >14 Ki67 level in patients.

Hotspot mutations of PIK3CA, create one of the major routes of activation of the PI3K signal and have been disclosed to be correlated with ER(+) condition [17]. According to previous research, high frequency of PIK3CA and FAT1 were detected in HR(+) patients, whereas high frequency of PIK3CA and ERBB2 mutations were detected in HER2(+) patients [18]. In a COX model, a ctDNA TP53 + PIK3CA gene mutation pattern successfully predicted disease progression within 6 months (17). Bartels et al. [19] concluded that CDKN2A loss and the PIK3CA mutation characterized a subgroup of metaplastic BCa patients with myoepithelial and spindle cell differentiation. PIK3CA mutations were found in 47% of menopausal women. Moreover, postmenopausal women with PIK3CA wild-type tumours had significantly worse disease-free survival [20]. On the other hand, in the current study, the incidence of TP53 mutations was significantly high in nod 0, ER(+) and HER2(+) BCa patients; however, no valuable statistical results in terms of the mutation frequency was found in luminal B, invasive ductal carcinoma, T2 tumour stage, G3 histological grade, >50 age, PR(+) and >14% Ki67 level in patients. In triple negative BCa, Shi et al. [21] in triple negative BCa detected very few recurrent mutations, including TP53 and PIK3CA, together with a long tail of individually rare. In another study, TP53 mutations were correlated with HER(+) BCa and younger age at diagnosis [22]. In a univariate analysis, Luo et al. [23] showed that MKI67, vascular invasion, CD117, CD117+/TP53 missense mutations+ and TP53 missense mutations were associated with overall survival of patients with TNBC.

In the present study, to analyse and detect all possible PIK3CA and TP53 gene mutations in BCa patients, we used a HRM assay, which offers a quick and cost-effective advanced methodology for detection of hotspot mutations. In the HRM assay, the mutations were identified based on different coloured peaks, and HRM variants were subjected to DNA sequencing using a DNA analyser to identify nucleotide variations. In the study, Sanger sequencing confirmed 89.2% of PIK3CA mutations and 62.04% of TP53 mutations detected in the HRM analysis, demonstrating that the method is a very forceful for detection of PIK3CA mutations. In regard to the outcome, cases with a mutation allele burden were better differentiated in reannealing than the melting step, as well as better separation of the wild-type from the mutant cases. As the length of the PCR products was closely, the Tm shift in curves was directly concerned to sequence variations. The HRM assay methodology was much more effective for PIK3CA gene mutation detection than TP53 gene mutation detection. This finding may be related to the lengths of the exons of the genes analysed.

According to the literature, PIK3R1 suppressed growth, invasiveness and metastatic properties of BCa cells. In addition, PIK3R1 was negatively regulated by miR-21, a direct target of miR-21 [24]. Andrade et al. [25] showed that among differentially expressed genes in normal epithelium, LCIS and ILC, using 23 patient-matched triplets of N, LCIS and ILC are demonstrated to be PIK3R1, GOLM1 and GPR137B genes. Cizkova et al. [26] reported underexpression of the PIK3R1 gene in 283 (61.8%) samples. Their study found that PIK3R1 underexpression was correlated with poorer metastasis-free survival. Also they reported that PIK3CA mutations were correlated to better metastasis-free survival. In the same study, by merging the PIK3CA mutation with PIK3R1 expression levels, four prognostic groups were showed with markedly different metastasis-free survival [26]. On the other hand, PIK3R1 gene expression levels in tumour tissue were higher than in non-tumour tissue in the present study. Moreover, PIK3R1 expression levels showed a statistically significant correlation with the G3 histological grade and ER(+), PR(+), HER2(+) and ER(+) status. PIK3R1, gene expression levels were higher in patients with PIK3CA mutations than in those without PIK3CA mutations, although the results were not statistically significant. The PIK3R1 gene expression level in patients with TP53 mutations was lower than that in patients without these mutations, with a statistically significant difference.

In previous research, loss of PTEN expression was related to ER(−), PR(−) and TNDC and marginally linked with distant metastasis. There was no correlation between PTEN loss and recurrence-free survival or overall survival [27]. Xu et al. [28] showed that mRNA expression levels of PTEN were significantly decreased in adjacent healthy tissues as compared with those in BCa tissues. In their research, miR142-5p and PTEN expression levels were positively and negatively correlated, respectively, with tumour size and metastasis. In the other study, 4% of patients with a PIK3CA mutation and/or low PTEN expression levels had a pCR as confront with 39% of patients with wild-type PIK3CA and high PTEN expression levels [29]. Furthermore, low PTEN levels and PIK3CA mutations predicted resistance to neoadjuvant lapatinib and trastuzumab treatment in the absence of chemotherapy in patients with HER2 overexpressing BCa [29]. According to the present our study, PTEN gene expression levels in tumour tissue were higher than those in healthy tissue. PTEN gene expression levels were higher in patients with PIK3CA mutations than in those without PIK3CA mutations, although the results were not statistically significant. PTEN expression levels showed a statistically significant correlation with the G3 histological grade and ER(+), PR(+), HER2(+) and ER(+) status.

Chen et al. [30] reported that SALL4 was upregulated in a drug-resistant BCa cell line, MCF-7/ADR. High cytoplasmic expression of SALL4 was analysed in BCa tissues as compared with that in healthy tissues. In addition, high SALL4 expression was associated with advanced tumour invasion, lymph node stage, ER, PR, HER2 and TNBC [31]. Itou et al. [32] showed that SALL4 overexpression suppressed the expression of adhesion gene CDH1 and positively regulated the CDH1 suppressor ZEB1. In the same study, SALL4 suppressed intercellular adhesion and maintained cell motility after cell-cell interactions and cell division, which resulted in a dispersed phenotype. In another study, the SALL4 mRNA expression level was high in 86.1% (31/36) of breast tumours, with no obvious correlation with clinicopathological factors. Moreover, SALL4 was expressed at a high level even in early clinical stages of cancer [33]. However, in our study the SALL4 gene expression level in tumour tissue was lower than that in healthy tissue. Although SALL4 was amplified in 62% of ER(+) patients, the finding was not statistically significant. SALL4 gene expression levels were higher in patients with PIK3CA mutations than in those without PIK3CA mutations, although the results were not statistically significant.

In the present study, we identified a high frequency of PIK3CA and TP53 mutations using a HRM assay in a Turkish BCa population. Previous studies reported that the expression levels of three genes (PIK3R1, PTEN and SALL4) played a significant role in BCa. The present study is the first to investigate the effects of five genes in the PI3K pathway. The mutation and gene expression analysis results shed light on the association of these genes with various histological and molecular parameters in BCa.

Conclusion

PIK3R1, PTEN and SALL4 gene expression analysis in patients with PIK3CA and TP53 mutations may be beneficial for the diagnosis of early-stage BCa in patients who have a high risk of a poor outcome. This study suggests that PIK3CA and TP53 gene mutations may be potential prognostic biomarkers of BCa and that PIK3R1, PTEN and SALL4 genes may be used in order to choose the best BCa treatment planning. We propose that these results should be considered in the evaluation of clinical parameters of BCa in the future.

Corresponding author: Mustafa Akkiprik, PhD, Department of Medical Biology, School of Medicine, Marmara University Faculty of Medicine, Başıbüyük Mah., Maltepe Başıbüyük Yolu Sok., No: 9/1, 34854 Maltepe- Istanbul, Turkey, Phone: +90 216421 22 22/1566

  1. Conflicts of interest: The authors declare no conflict of interest.

  2. Funding: This work was funded by the (SAG-C-DRP-100216-0040 to M.A.) from Marmara University (BAPKO).

  3. Ethical approval: The ethical approval certificate was taken for this preclinical study from Marmara University Faculty of Medicine (09.2015.264).

References

1. Martin HL, Smith L, Tomlinson DC. Multidrug-resistant breast cancer: current perspectives. Breast Cancer 2014;6:1–13.10.2147/BCTT.S37638Search in Google Scholar

2. Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al. Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer 2015;136:E359–86.10.1002/ijc.29210Search in Google Scholar PubMed

3. Naushad SM, Divya C, JanakiRamaiah M, Hussain T, Alrokayan SA, Kutala VK. Population-level diversity in the association of genetic polymorphisms of one-carbon metabolism with breast cancer risk. J Community Genet 2016;7:279–90.10.1007/s12687-016-0277-1Search in Google Scholar PubMed PubMed Central

4. Cancer Genome Atlas N. Comprehensive molecular por traits of human breast tumours. Nature 2012;490:61–70.10.1038/nature11412Search in Google Scholar PubMed PubMed Central

5. Costa RLB, Han HS, Gradishar WJ. Targeting the PI3K/AKT/mTOR pathway in triple-negative breast cancer: a review. Breast Cancer Res Treat 2018;169:397–406.10.1007/s10549-018-4697-ySearch in Google Scholar PubMed

6. LoRusso PM. Inhibition of the PI3K/AKT/mTOR pathway in solid tumors. J Clin Oncol 2016;34:3803–15.10.1200/JCO.2014.59.0018Search in Google Scholar PubMed PubMed Central

7. Catalogue of Somatic Mutations in Cancer (COSMIC). Date of Access: 15 May 2018. https://cancer.sanger.ac.uk/cosmic.Search in Google Scholar

8. Hesari A, Rajab S, Rezaei M, Basam M, Golmohamadi S, Ghasemi F. Knockdown of Sal-like 4 expression by siRNA induces apoptosis in colorectal cancer. J Cell Biochem 2019;120:11531–8.10.1002/jcb.28433Search in Google Scholar PubMed

9. Dirican E, Kaya Z, Gullu G, Peker I, Ozmen T, Gulluoglu BM, et al. Detection of PIK3CA gene mutations with HRM analysis and association with IGFBP-5 expression levels in breast cancer. Asian Pac J Cancer Prev 2014;15:9327–33.10.7314/APJCP.2014.15.21.9327Search in Google Scholar PubMed

10. Goldhirsch A, Winer EP, Coates AS, Gelber RD, Piccart-Gebhart M, Thürlimann B, et al. Panel members- Personalizing the treatment of women with early breast cancer: highlights of the St Gallen International Expert Consensus on the Primary Therapy of Early Breast Cancer 2013. Ann Oncol 2013;24:2206–23.10.1093/annonc/mdt303Search in Google Scholar PubMed PubMed Central

11. Ney JT, Froehner S, Roesler A, Buettner R, Merkelbach-Bruse S. High- resolution melting analysis asa sensitive prescreening diagnostic tool to detect KRAS, BRAF, PIK3CA, and AKT1 mutations in formalin-fixed, paraffin-embedded tissues. Arch Pathol Lab Med 2012;136:983–92.10.5858/arpa.2011-0176-OASearch in Google Scholar PubMed

12. Yamanoshita O, Kubota T, Hou J, Ping YM, Zhang XL, Li XP, et al. DHPLC is superior to SSCP in screeningp53mutations in esophageal cancer tissues. Int J Cancer 2005;114:74–9.10.1002/ijc.20712Search in Google Scholar PubMed

13. Shimoi T, Hamada A, Yamagishi M, Hirai M, Yoshida M, Nishikawa T, et al. PIK3CA mutation profiling in patients with breast cancer, using a highly sensitive detection system. Cancer Sci 2018;109:2558–66.10.1111/cas.13696Search in Google Scholar PubMed PubMed Central

14. Takeshita T, Yamamoto Y, Yamamoto-Ibusuki M, Tomiguchi M, Sueta A, Iwase H. ESR1 and PIK3CA mutational status in serum and plasma from metastatic breast cancerpatients: a comparative study. Cancer Biomark 2018;22:345–50.10.3233/CBM-171161Search in Google Scholar PubMed

15. Chen L, Yang L, Yao L, Kuang XY, Zuo WJ, Li S, et al. Characterization of PIK3CA and PIK3R1 somatic mutations in Chinese breast cancer patients. Nat Commun 2018;9:1357.10.1038/s41467-018-03867-9Search in Google Scholar PubMed PubMed Central

16. Meric-Bernstam F, Zheng X, Shariati M, Damodaran S, Wathoo C, et al. Survival outcomes by TP53 mutation status in metastatic breast cancer. JCO Precis Oncol 2018;2018. doi: 10.1200/PO.17.00245.Search in Google Scholar PubMed PubMed Central

17. Saal LH, Holm K, Maurer M, Memeo L, Su T, Wang X, et al. PIK3CA mutations correlate with hormone receptors, node metastasis, and ERBB2, and are mutually exclusive with PTEN loss in human breast carcinoma. Cancer Res 2005;65:2554–9.10.1158/0008-5472-CAN-04-3913Search in Google Scholar PubMed

18. Hu ZY, Xie N, Tian C, Yang X, Liu L, Li J, et al. Identifying circulating tumor DNA mutation profiles in metastatic breast cancer patients with multiline resistance. E Bio Medicine 2018;32:111–8.10.1016/j.ebiom.2018.05.015Search in Google Scholar PubMed PubMed Central

19. Bartels S, van Luttikhuizen JL, Christgen M, Mägel L, Luft A, Hänzelmann S, et al. CDKN2A loss and PIK3CA mutationin myoepithelial-like metaplastic breast cancer. J Pathol 2018;245:373–83.10.1002/path.5091Search in Google Scholar PubMed

20. Ishida N, Baba M, Hatanaka Y, Hagio K, Okada H, Hatanaka KC, et al. PIK3CAmutation, reduced AKT serine 473 phosphorylation, and increased ERα serine 167 phosphorylation are positive prognostic indicators in postmenopausal estrogen receptor-positive early breast cancer. Oncotarget 2018;9:17711–24.10.18632/oncotarget.24845Search in Google Scholar PubMed PubMed Central

21. Shi Y, Jin J, Ji W, Guan X. Therapeutic landscape in mutational triple negative breast cancer. Mol Cancer 2018;17:99.10.1186/s12943-018-0850-9Search in Google Scholar PubMed PubMed Central

22. Li J, Jing R, Wei H, Wang M, Xiaowei Q, Liu H, et al. Germline mutations in 40 cancer susceptibility genes among Chinese patients with high hereditary risk breast cancer. Int J Cancer 2019;144:281–9.10.1002/ijc.31601Search in Google Scholar PubMed

23. Luo Y, Huang W, Zhang H, Liu G. Prognostic significance of CD117 expression and TP53missense mutations in triple-negative breast cancer. Oncol Lett 2018;15:6161–70.10.3892/ol.2018.8104Search in Google Scholar

24. Yan LX, Liu YH, Xiang JW, Wu QN, Xu LB, Luo XL, et al. PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer. Int J Oncol 2016;48:471–84.10.3892/ijo.2015.3287Search in Google Scholar PubMed PubMed Central

25. Andrade VP, Morrogh M, Qin LX, Olvera N, Giri D, Muhsen S, et al. Gene expression profiling of lobular carcinoma in situ reveals candidate precursor genes for invasion. Mol Oncol 2015;9:772–82.10.1016/j.molonc.2014.12.005Search in Google Scholar PubMed PubMed Central

26. Cizkova M, Vacher S, Meseure D, Trassard M, Susini A, Mlcuchova D, et al. PIK3R1 underexpression is an independent prognostic marker in breast cancer. BMC Cancer 2013;13:545.10.1186/1471-2407-13-545Search in Google Scholar PubMed PubMed Central

27. Khan F, Esnakula A, Ricks-Santi LJ, Zafar R, Kanaan Y, Naab T. Loss of PTEN in high grade advanced stage triple negative breast ductal cancers in African American women. Pathol Res Pract 2018;214:673–8.10.1016/j.prp.2018.03.020Search in Google Scholar PubMed PubMed Central

28. Xu W, Wang W. MicroRNA 142 5p modulates breast cancer cell proliferation and apoptosis by targeting phosphatase and tensin homolog. Mol Med Rep 2018;17:7529–36.10.3892/mmr.2018.8812Search in Google Scholar PubMed PubMed Central

29. Rimawi MF, De Angelis C, Contreras A, Pareja F, Geyer FC, Burke KA, et al. Low PTEN levels and PIK3CA mutations predict resistance to neoadjuvant lapatinib and trastuzumab without chemotherapy in patients with HER2 over-expressing breast cancer. Breast Cancer Res Treat 2018;167:731–40.10.1007/s10549-017-4533-9Search in Google Scholar PubMed PubMed Central

30. Chen YY, Li ZZ, Ye YY, Xu F, Niu RJ, Zhang HC, et al. Knockdown of SALL4 inhibits the proliferation and reverses the resistance of MCF-7/ADR cells to doxorubicin hydrochloride. BMC Mol Biol 2016;17:6.10.1186/s12867-016-0055-ySearch in Google Scholar PubMed PubMed Central

31. Yue X, Xiao L, Yang Y, Liu W, Zhang K, Shi G, et al. High cytoplasmic expression of SALL4 predicts a malignant phenotype and poor prognosis of breastinvasive ductal carcinoma. Neoplasma 2015;62:980–8.10.4149/neo_2015_119Search in Google Scholar PubMed

32. Itou J, Matsumoto Y, Yoshikawa K, Toi M. Sal-like 4 (SALL4) suppresses CDH1 expression and maintains cell dispersion in basal-like breast cancer. FEBS Lett 2013;587:3115–21.10.1016/j.febslet.2013.07.049Search in Google Scholar PubMed

33. Kobayashi D, Kuribayshi K, Tanaka M, Watanabe N. SALL4 is essential for cancer cell proliferation and is overexpressed at early clinical stages in breast cancer. Int J Oncol 2011;38: 933–9.10.3892/ijo.2011.929Search in Google Scholar

Supplementary Material

The online version of this article offers supplementary material (https://doi.org/10.1515/tjb-2019-0137).

Received: 2019-04-03
Accepted: 2019-11-28
Published Online: 2020-03-02

©2020 Walter de Gruyter GmbH, Berlin/Boston

Articles in the same Issue

  1. Frontmatter
  2. Review Article
  3. Newly developed diagnostic methods for SARS-CoV-2 detection
  4. Short Communication
  5. Effect of hemolysis on prealbumin assay
  6. Research Articles
  7. BioVar: an online biological variation analysis tool
  8. High dose ascorbic acid treatment in COVID-19 patients raised some problems in clinical chemistry testing
  9. Immunoassay biomarkers of first and second trimesters: a comparison between pregnant Syrian refugees and Turkish women
  10. Association of maternal serum trace elements with newborn screening-thyroid stimulating hormone
  11. PIK3CA and TP53 MUTATIONS and SALL4, PTEN and PIK3R1 GENE EXPRESSION LEVELS in BREAST CANCER
  12. Evaluation of E2F3 and survivin expression in peripheral blood as potential diagnostic markers of prostate cancer
  13. Age, gender and season dependent 25(OH)D levels in children and adults living in Istanbul
  14. Original Article
  15. Fractional excretion of magnesium as an early indicator of renal tubular damage in normotensive diabetic nephropathy
  16. Research Articles
  17. Diagnostic value of laboratory results in children with acute appendicitis
  18. Evaluation of thiol disulphide levels in patients with pulmonary embolism
  19. Relationship between renal tubulointerstitial fibrosis and serum prolidase enzyme activity
  20. Comparison of test results obtained from lithium heparin gel tubes and serum gel tubes
  21. MHC Class I related chain A (MICA), Human Leukocyte Antigen (HLA)-DRB1, HLA-DQB1 genotypes in Turkish patients with ulcerative colitis
  22. An overview of procalcitonin in Crimean-Congo hemorrhagic fever: clinical diagnosis, follow-up, prognosis and survival rates
  23. Comparison of different equations for estimation of low-density lipoprotein (LDL) – cholesterol
  24. Case-Report
  25. A rare case of fructose-1,6-bisphosphatase deficiency: a delayed diagnosis story
  26. Research Articles
  27. Atypical cells in sysmex UN automated urine particle analyzer: a case report and pitfalls for future studies
  28. Investigation of the relationship cellular and physiological degeneration in the mandible with AQP1 and AQP3 membrane proteins
  29. In vitro assessment of food-derived-glucose bioaccessibility and bioavailability in bicameral cell culture system
  30. Letter to the Editor
  31. The weighting factor of exponentially weighted moving average chart
https://doi.org/10.1515/tjb-2019-0137
Keywords for this article
Breast cancer; PI3K; PIK3CA; HRM; Candidate genes

Articles in the same Issue

  1. Frontmatter
  2. Review Article
  3. Newly developed diagnostic methods for SARS-CoV-2 detection
  4. Short Communication
  5. Effect of hemolysis on prealbumin assay
  6. Research Articles
  7. BioVar: an online biological variation analysis tool
  8. High dose ascorbic acid treatment in COVID-19 patients raised some problems in clinical chemistry testing
  9. Immunoassay biomarkers of first and second trimesters: a comparison between pregnant Syrian refugees and Turkish women
  10. Association of maternal serum trace elements with newborn screening-thyroid stimulating hormone
  11. PIK3CA and TP53 MUTATIONS and SALL4, PTEN and PIK3R1 GENE EXPRESSION LEVELS in BREAST CANCER
  12. Evaluation of E2F3 and survivin expression in peripheral blood as potential diagnostic markers of prostate cancer
  13. Age, gender and season dependent 25(OH)D levels in children and adults living in Istanbul
  14. Original Article
  15. Fractional excretion of magnesium as an early indicator of renal tubular damage in normotensive diabetic nephropathy
  16. Research Articles
  17. Diagnostic value of laboratory results in children with acute appendicitis
  18. Evaluation of thiol disulphide levels in patients with pulmonary embolism
  19. Relationship between renal tubulointerstitial fibrosis and serum prolidase enzyme activity
  20. Comparison of test results obtained from lithium heparin gel tubes and serum gel tubes
  21. MHC Class I related chain A (MICA), Human Leukocyte Antigen (HLA)-DRB1, HLA-DQB1 genotypes in Turkish patients with ulcerative colitis
  22. An overview of procalcitonin in Crimean-Congo hemorrhagic fever: clinical diagnosis, follow-up, prognosis and survival rates
  23. Comparison of different equations for estimation of low-density lipoprotein (LDL) – cholesterol
  24. Case-Report
  25. A rare case of fructose-1,6-bisphosphatase deficiency: a delayed diagnosis story
  26. Research Articles
  27. Atypical cells in sysmex UN automated urine particle analyzer: a case report and pitfalls for future studies
  28. Investigation of the relationship cellular and physiological degeneration in the mandible with AQP1 and AQP3 membrane proteins
  29. In vitro assessment of food-derived-glucose bioaccessibility and bioavailability in bicameral cell culture system
  30. Letter to the Editor
  31. The weighting factor of exponentially weighted moving average chart
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 5.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/tjb-2019-0137/html
Scroll to top button