Home Molecular detection of Bacillus anthracis: evaluation of the efficiency of DNA extraction and a novel dry PCR
Article Publicly Available

Molecular detection of Bacillus anthracis: evaluation of the efficiency of DNA extraction and a novel dry PCR

  • Mesut Ortatatli ORCID logo , Levent Kenar EMAIL logo , Sermet Sezigen , Koray Eyison and Huseyin Oktem
Published/Copyright: June 20, 2019
Download Article (PDF)
Turkish Journal of Biochemistry
From the journal Turkish Journal of Biochemistry Volume 44 Issue 2

Abstract

Background

Due to recent increase in mailings of anthrax spores, the detection of bioweapons has gained a great deal of interest. This study aimed to investigate the yield and purity of DNA obtained from spores and vegetative forms of Bacillus anthracis for detection by conventional (wet) and dry (lyophilized) PCR methods.

Materials and methods

Biosamples from stock solution were reconstituted to a concentration 108 cfu/mL followed by the spectrophotometric measurement of the yield and purity of acquired DNA. Twelve wet and 12 dry PCR studies of four various DNA dilution samples were performed for each three target gene (cap, pag, sap) of B. anthracis.

Results

Significant differences for both DNA yields and purity were found between liquid-agar and liquid-spore samples. No significant difference was observed between wet and dry PCR in concentration of 2.5 ng/μL DNA for all gene regions. PCR results of sap gene region with DNA concentrations of 1.5 ng/μL and 0.9 ng/μL was found statistically significant in favor of conventional wet PCR method (p = 0.047 and p ≤ 0.001, respectively).

Conclusion

It is concluded that B. anthracis cultivated in liquid medium is more usable than vegetative or spore form obtained on plate agar for proper DNA extraction.

Öz

Amaç

Son zamanlarda antraks sporlarının postalayla gönderilmesindeki artış nedeniyle, biyolojik silahların tespiti büyük önem kazanmıştır. Bu çalışma, Bacillus anthracis’in konvansiyonel (ıslak) ve kuru (liyofilize) PCR yöntemleri ile saptanmasında spor ve vejetatif formlardan elde edilen DNA’nın miktar ve saflığını araştırmayı amaçlamıştır.

Gereç ve Yöntem

Stok çözeltiden elde edilen numuneler 108 cfu/mL konsantrasyona getirildi, ardından elde edilen DNA’nın miktar ve saflığı spektrofotometrik yöntemle ölçüldü. Dört farklı DNA dilüsyonunda B. anthracis’in üç hedef gen bölgesine (cap, pag, sap) yönelik 12 ıslak ve 12 kuru PCR çalışması gerçekleştirildi.

Bulgular

Sıvı-agar ve sıvı-spor örnekleri arasında hem DNA miktarı hem de saflığı açısından istatistiksel önemli fark bulundu. Tüm gen bölgeleri için 2.5 ng/μL DNA konsantrasyonunda ıslak ve kuru PCR arasında anlamlı bir fark gözlenmedi. Sap gen bölgesine yönelik uygulanan PCR’da, 1.5 ng/μL ve 0.9 ng/μL DNA konsantrasyonlarında konvansiyonel ıslak PCR yöntemi lehine istatistiksel anlamlı fark belirlendi (sırasıyla, p = 0.047 ve p ≤ 0.001).

Sonuç

Uygun DNA ekstraksiyonu açısından sıvı ortamda üretilen B. anthracis’in agarda üretilen vejetatif veya spor formundan daha uygun olduğu sonucuna varılmıştır.

Keywords: Bacillus anthracis; Vegetative form; Spore form; DNA extraction; Dry PCR
Anahtar Kelimeler: Bacillus anthracis; vejetatif form; spor form; DNA ekstraksiyonu; kuru PCR

Introduction

Bacillus anthracis, a Gram-positive spore forming rod, is the causative agent of anthrax and one of the organisms classified as biological warfare agents. Spores germinate within the host to produce vegetative forms, which multiply and express their virulence factors, killing the host. In case of outbreak or any intentional release, rapid and sensitive detection is essential for prevention of public. Although the gold standard for diagnosis is culture and identification of the agent by routine bacteriological methods, these procedures are laborious and time-consuming. Since then, molecular-based methodological approaches have been developed to detect DNA traces of B. anthracis from various samples and widely applied as diagnostic tools. However, an efficient DNA extraction in adequate quantity and quality, when using those molecular methods is an essential concern [1], [2].

Gram-positive bacteria are supposed to be more difficult to lyse because they have thicker cell wall structure, when compared with those of Gram-negative bacteria with thinner and simpler cell wall. Another important factor for indicating the yield of DNA is its existence in either vegetative or spore form of bacteria, because endospores possess thicker multilayer structure that provides resistance to ultraviolet radiation, high temperatures, freezing, chemical and mechanical stress [3], [4].

To estimate the yield and purity of extracted nucleic acid can be used the absorbance at 260 nm and A260/A280 ratio, respectively. Samples with mean A260/A280 ratios between 1.8 and 2.2 has indicated highly purified preparations of DNA. Samples with mean A260/A280 ratios below 1.8 are supposed to contain protein or other contaminants, whereas samples with ratios above 2.0 might be due to the presence of RNA [5], [6]. One of the other method for quantifying DNA yields is PicoGreen modifying the dye fluorescence and real-time PCR [3].

Several primers for PCR have been developed to detect chromosomal genes, virulent plasmids pXO1 and pXO2 of B. anthracis. Due to the very close similarity of B. anthracis chromosomal genes from other bacteria in Bacillus cereus group, target genes encoded by two virulence plasmids have been commonly used as a marker for differentiation. However, some B. anthracis strains containing only one virulence plasmid may occur naturally and therefore a combination of plasmid and chromosomal markers is recommended for accurate identification [7], [8], [9], [10].

There are several commercially available master mixes including the components (except primers, probes, template, and water) for performing easy PCR assay. These commercial kits allow to decrease the time period required for assay set-up and improve the throughput [11].

This study aims to evaluate efficiency of recovery of DNA extraction from vegetative cells grown in Tryptic Soy Broth (TSB) and on sheep blood agar (SBA) and from the spores of B. anthracis. One of the challenging aims of this study is also to determine the effect of culture medium and form of bacteria for yield and purity of DNA extraction. Additionally, the efficiencies of conventional PCR (wet) and a novel dry PCR method were compared for the molecular detection of B. anthracis, a biowarfare agent.

Materials and methods

Preparation of bacteria

Bacillus anthracis bacteria were supplied from the stock collections obtained for the study performed by Ortatatli et al. [12]. Bacteria were incubated on SBA and in TSB for 24 h at 37°C. Then, the bacteria cultivated on SBA were divided into two groups: a group of vegetative agar medium stored in 0.9% saline and another group of spores which were kept at 4°C for 7 days following 24 h of storage at room temperature for sporulation. Spore formation was observed daily by spore staining using the Schaeffer-Fulton spore stain kit (Sigma-Aldrich, Buchs, Swiss) until a 95% sporulation rate was achieved.

Spore and two vegetative forms of B. anthracis samples were equilibrated to McFarland 0.5 with sterile saline so that the count of bacteria would be 108 CFU/mL at most.

DNA extraction

According to the outline the kit manufacturer recommended, a silica-gel spin column technology based DNA4U Bacterial Genomic Kit (NANObiz, Ankara, Turkey) was used for the procedures of DNA extraction from spores and vegetative forms of B. anthracis that were grown on agar and in liquid mediums. The yield and purity of acquired DNA was measured using NanoDrop 2000 Spectrophotometer (ND Technologies, Wilmington, DE, USA) at 260 nm and 260/280 nm ratio, respectively. For this purpose, a dilution step of a stock solution of an amount of 5 ng/μL DNA extract was conducted to the ratios of 10−1, 10−2, 10−3, and 10−4 which was followed by the measurements of DNA yield.

PCR analysis

A SensoQuest Labcycler (SensoQuest, Göttingen, Germany) instrument was used for PCR analysis and previously designed primers [13], [14], [15] which were specific to three target genes (cap, pag, sap) of B. anthracis were also used (Table 1). We performed PCR reactions with a sample volume of 25 μL and reaction mixture contained 2 μL buffer, MgCl2 (2.5 mM), dNTP (2.5 mM), 0.4 μL of each primers (10 μM) and 0.2 μL Taq polymerase. Final concentration was obtained with addition of 5 μL template DNA and 13 μL dH2O. The cycling parameters of cap and pag genes were: initial denaturation at 95°C for 5 min followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s and final extension at 72°C for 10 min. However, PCR conditions for sap gene were almost similar excluding temperatures of initial denaturation and annealing were 94°C and 52°C, respectively.

Table 1:

Primers used in this study.

PrimerSequence (5′-3′)Target geneProduct sizeReference
CAP1234CTGAGCCATTAATCGATATGcap846 bp[13]
CAP1301TCCCACTTACGTAATCTGAG
PA5TCCTAACACTAACGAAGTCGpag596 bp[14]
PA8GAGGTAGAAGGATATACGGT
S-layer UpperCGCGTTTCTATGCCATCTCTTCTsap639 bp[15]
S-layer LowerTTCTGAAGCTGGCGTTACAAAT

PCR reaction mixtures except DNA and dH2O content were prepared and stored in lyophilized form for further dried PCR analysis. Reaction mixture samples freshly prepared in a variety of PCR reaction tubes for conventional PCR analysis.

After the reaction, PCR products were run in 1.5% agarose gel stained with ethidium bromide and screened under UV light.

Statistical tests

According to the G*Power V3.1 statistical analysis program, 12 samples were distributed to each group by comparing the differences in the dependent groups with two-tailed hypothesis tests and with the acceptance of a 95% confidence interval with an 80% power and one effect size.

Statistical analyses of data were done through SPSS 15.0 software (SPSS Inc., Chicago, IL, USA). Comparisons of DNA extractions were analyzed with one-way analysis of variance (ANOVA), followed by Tukey’s HSD test (set at 5%) to perform mean pairwise comparisons when significant differences were observed. PCR results were assessed with Fisher’s Exact Test. The value of p<0.05 was considered significantly different between groups.

Results

Comparison of DNA yields and purities

Two vegetative forms obtained from TBS and BSA, and spore form of B. anthracis were subjected to DNA extraction. DNA yields and purity of these extractions were determined in each group and compared with each other.

The mean and standard deviation of DNA yields which were obtained from vegetative cells cultivated in TSB and SBA were 9.28±1.09 ng/μL and 4.22±0.43 ng/μL, respectively, and purity of extractions were found 1.98±0.05 and 2.72±0.21, respectively. DNA yields and purity of B. anthracis spores were 3.05±0.19 ng/μL and 2.83±0.25, respectively.

For both DNA yields and purities, the differences between three sample groups were found to be significant by One-way ANOVA (p<0.001 and p=0.006, respectively). Tukey’s HSD multiple comparison test revealed no significant differences between agar and spore samples for both DNA yields and purities (p=0.458 and p=0.915, respectively); however, differences for both DNA yields and purities were found statistically significant between liquid and agar samples (p<0.001 and p=0.009, respectively), and between liquid and spore samples (p<0.001 and p=0.025, respectively). The box plots graphs illustrating DNA yield and purity were given in Figures 1 and 2.

Figure 1: Box plots of DNA yields (ng/μL) acquired from samples. Liquid, Vegetative form obtained from TSB; Agar, Vegetative form obtained from SBA; and Spore, Spore form obtained from SBA.
Figure 1:

Box plots of DNA yields (ng/μL) acquired from samples. Liquid, Vegetative form obtained from TSB; Agar, Vegetative form obtained from SBA; and Spore, Spore form obtained from SBA.

Figure 2: Box plots of purity of DNA (260/280 nm ratio) acquired from samples.Liquid, Vegetative form obtained from TSB; Agar, Vegetative form obtained from SBA; and Spore, Spore form obtained from SBA.
Figure 2:

Box plots of purity of DNA (260/280 nm ratio) acquired from samples.

Liquid, Vegetative form obtained from TSB; Agar, Vegetative form obtained from SBA; and Spore, Spore form obtained from SBA.

Assessment of efficiency and limit of detection of PCR methods

Both PCR methods [classic (wet) and lyophilized (dry)] with the same mixtures were assayed for determination of efficiencies and detection limits. For this purpose, since a 5-μL volume of sample was used for PCR reactions, a total 12.5 ng DNA was obtained from 2.5 ng/μL concentration for the PCR reactions. Our results obtained for the gene region sap, cap and pag PCR suggested no significant difference between wet and dry PCR in concentration of 2.5 ng/μL DNA. PCR results of sap gene region with DNA concentrations of 1.5 ng/μL and 0.9 ng/μL was found statistically significant in favor of conventional wet PCR method (p=0.047 and p≤0.001, respectively). However, no positive result was found in concentration with 0.5 ng/μL DNA in all PCR studies. Table 2 shows DNA concentrations found for DNA dilutions and PCR results of 12 repetitive studies.

Table 2:

Results of dilutions from the 5 ng/μL DNA and 12 repetitive PCR studies.

Dilution RatioMeasured DNA (ng/μL)Loaded DNA on PCR (ng)Wet PCR results of gene regionsDry PCR results of gene regions
sapcappagsapcappag
10−12.512.512111211911
10−21.57.512a11128a711
10−30.94.512b6111b77
10−40.52.5000000

  1. a,bA statistical significant result was found in comparison, pa=0.047; pb≤0.001.

In this study, the effectivity and availability of dry PCR method developed for specifically B. anthracis detection in routine analytical laboratories unneeded higher biosafety conditions were evaluated to eliminate technician’s mistake and possible contamination. When the efficiencies of both PCR methods were compared, PCR results of sap gene region with DNA concentrations of 7.5 ng and 4.5 ng was found statistically significant in favor of conventional wet PCR method (p=0.047 and p≤0.001, respectively).

Discussion

A number of studies comparing the efficiency of various DNA extraction methods and kits showed no differences between purity (260/280 ratio), quality (evaluation of PCR products) and DNA concentrations of extracted DNA [2], [3], [8], [16]. While various DNA extraction methods have been evaluated for single introduced microorganism [6] and investigated the efficiency for both Gram-positive and Gram-negative bacteria [3], no single study comparing the extraction methods for both bacterial spore and vegetative forms cultivated in different media has been reported. One parameter that has received little attention in terms of its effect on DNA extraction is whether cultivation is in liquid medium or on plates. In our study, we investigated the effects of both bacterial form and source of cultivation on the sufficient DNA extraction. We evaluated the yield and purity of B. anthracis DNA extracted from different forms obtained from various media. In addition, we compared the efficiency of conventional (wet) and dry PCR techniques for the diagnosis of B. anthracis. It should be emphasized one more time that we had found DNA yields and purity of B. anthracis spores as 3.05±0.19 ng/μL and 2.83±0.25, respectively.

Some studies reported that the DNA amounts obtained from the Gram-negative bacteria were found increased twice or 10 times more than the amounts from the spores of Bacillus genus bacterial collections [3], [17]. Bacterial spores are structured with multilayer wall of a peptidoglycan cortex at inner space and a protein cover located in the outer layer [18]. So, extraction procedures are highly expected to be able to obtain DNA from these very resistant endospores.

Although our study resulted in a statistically significant difference between the DNA extract yields obtained from vegetative B. anthracis grown in liquid medium and on agar plate, the comparison of DNA yields from those grown on agar and spores gave no significant difference. Thus, these finding may point out that cellular wall of a Gram positive bacteria like B. anthracis on liquid medium can be more vulnerable to lysosomal enzymes than the cell wall of those grown on agar medium. Likewise, as reported by Rose et al. spores produced on agar were found more resistant to various chemicals than those made in liquid medium [19]. As concluded, more studies are needed aiming the different degrees of effect of medium on efficiency of DNA extracts.

Sohni et al. also studied B. anthracis DNA extraction from liquid culture using silica gel spin column technology and found A260/280 ratios of 1.9±0.1 [11]. We used the same method and vegetative B. anthracis extraction obtained from TBS and SBA gave the ratios of 1.98±0.05 and 2.72±0.21, respectively. The least pure DNA yielded was found from spore form giving a value of 2.83±0.25. However, the samples from plate agar (both for vegetative and spore forms) resulted that sample matrices could affect the efficiency of extraction for recovering pure DNA. This finding showed that DNA was likely contaminated which required some further purification procedures before the PCR assay.

Since various factors may affect the sensitivity of PCR assays, including DNA yield and purity, developing an optimal extraction method becomes crucial. Dauphin et al. showed that purity was a more important factor than that of yield for the detection of B. anthracis DNA by real-time PCR assay at low concentrations of DNA (≤2.0 to 16.5 ng/μL). According to their results, PCR assay was optimal when 2 ng of DNA extract with the purity of 1.8 was added into 25 μL PCR tube, but to obtain positive PCR results the quality of DNA extract had to be increased up to 3 ng if DNA purity would become less than 1.8 [6].

Another aim of our study was to make an assessment about effectiveness of correlation between conventional (wet) and lyophilized (dry) PCR methods for sap, cap, pag gene regions regardless of the purity of DNA extract and extraction method. The use of multiple targets decreased the rate of false-positive and false-negative results. In order to increase the specificity of the assay, each target was amplified in separate PCR reaction. Only template DNA and water were added to perform the dry PCR assay, because all reagents were already kept lyophilized in PCR tubes. We carried out PCR assay for three target genes by using DNA with the amount of 2.5 ng/μL which was 12.5 ng total for PCR analysis and concluded that both dry and wet methods were considerably sensitive methods having no statistical difference in between. Table 2 describes that no statistically significant difference was found for the sensitivities cap and pag gene regions, but sap gene region gave a significant sensitivity for the concentrations with 1.5 ng/μL and 0.9 ng/μL. These findings pointed out that the effective purity of DNA template used in the assay might be completely provided at lower concentrations with decreased PCR sensitivity.

Sohni et al. compared the efficiency of five commercial real-time PCR reagent systems using TaqMan assays for B. anthracis detection and determined the limit of detection under 1 ng of template DNA for proB and pag genes. They added master mix, primers and probes, template DNA, and water into PCR tubes [11].

In conclusion, this study has shown that vegetative or spore forms of B. anthracis obtained on plate agar are less suitable than B. anthracis from liquid medium for sufficient DNA extraction. Therefore, it is suggested that DNA extraction for biomolecular diagnostic tests such as PCR should be carried out by using the bacteria which are cultivated or enriched in liquid medium. Although easy to go PCR reagent systems could reduce assay sensitivity, less lab staff contributions in assay set-up with less lead operator errors may improve accuracy and precision of the study. In addition, dried PCR tubes specially designed for the subject agent may also be kept stored at room temperature and cause using for developing the molecular-based biosensors.

  1. Conflict of interest statement: There are no conflicts of interest among the authors.

References

1. Brauge T, Faille C, Inglebert G, Dubois T, Morieux P, Slomianny C, et al. Comparative evaluation of DNA extraction methods for amplification by qPCR of superficial vs. intracellular DNA from Bacillus spores. Int J Food Microbiol 2018;266:289–94.10.1016/j.ijfoodmicro.2017.12.012Search in Google Scholar PubMed

2. Kalousova M, Levova K, Kubena AA, Jachymova M, Frankova V, Zima T. Comparison of DNA isolation using salting-out procedure and automated isolation (MagNA system). Prep Biochem Biotechnol 2017;47:703–8.10.1080/10826068.2017.1303613Search in Google Scholar PubMed

3. Bowman S, Roffey P, McNevin D, Gahan ME. Evaluation of commercial DNA extraction methods for biosecurity applications. Aust J Forensic Sci 2016;48:407–20.10.1080/00450618.2015.1106585Search in Google Scholar

4. Nicholson WL, Munakata N, Horneck G, Melosh HJ, SetlowP. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiol Mol Biol Rev 2000;64:548–72.10.1128/MMBR.64.3.548-572.2000Search in Google Scholar PubMed PubMed Central

5. Manchester KL. Value of A260/A280 ratios for measurement of purity of nucleic acids. Biotechniques 1995;19:208–10.Search in Google Scholar

6. Dauphin LA, Moser BD, Bowen MD. Evaluation of five commercial nucleic acid extraction kits for their ability to inactivate Bacillus anthracis spores and comparison of DNA yields from spores and spiked environmental samples. J Microbiol Methods 2009;76:30–7.10.1016/j.mimet.2008.09.004Search in Google Scholar PubMed

7. Helgason E, Okstad OA, Caugant DA, Johansen HA, Fouet A, Mock M, et al. Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis – one species on the basis of genetic evidence. Appl Environ Microbiol 2000;66:2627–630.10.1128/AEM.66.6.2627-2630.2000Search in Google Scholar PubMed PubMed Central

8. Mertens K, Freund L, Schmoock G, Hansel C, Melzer F, ElschnerMC. Comparative evaluation of eleven commercial DNA extraction kits for real-time PCR detection of Bacillus anthracis spores in spiked dairy samples. Int J Food Microbiol 2014;170:29–37.10.1016/j.ijfoodmicro.2013.10.022Search in Google Scholar PubMed

9. Rao SS, Mohan KV, Atreya CD. Detection technologies for Bacillus anthracis: prospects and challenges. J Microbiol Methods 2010;82:1–10.10.1016/j.mimet.2010.04.005Search in Google Scholar PubMed

10. Ogawa H, Fujikura D, Ohnuma M, Ohnishi N, Hang’ombe BM, Mimuro H, et al. A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species. PLoS One 2015;10:e0122004.10.1371/journal.pone.0122004Search in Google Scholar PubMed PubMed Central

11. Sohni Y, Kanjilal S, Kapur V. Performance evaluation of five commercial real-time PCR reagent systems using TaqMan assays for B. anthracis detection. Clin Biochem 2008;41:640–4.10.1016/j.clinbiochem.2008.01.007Search in Google Scholar PubMed

12. Ortatatli M, Karagoz A, Percin D, Kenar L, Kilic S, Durmaz R. Antimicrobial susceptibility and molecular subtyping of 55 Turkish Bacillus anthracis strains using 25-loci multiple-locus VNTR analysis. Comp Immunol Microbiol Infect Dis 2012;35:355–61.10.1016/j.cimid.2012.02.005Search in Google Scholar

13. Hutson RA, Duggleby CJ, Lowe JR, Manchee RJ, Turnbull PC. The development and assessment of DNA and oligonucleotide probes for the specific detection of Bacillus anthracis. J Appl Bacteriol 1993;75:463–72.10.1111/j.1365-2672.1993.tb02803.xSearch in Google Scholar

14. Beyer W, Glockner P, Otto J, Bohm R. A nested PCR method for the detection of Bacillus anthracis in environmental samples collected from former tannery sites. Microbiol Res 1995;150:179–86.10.1016/S0944-5013(11)80054-6Search in Google Scholar

15. Organization WH. Guidelines for the surveillance and control of anthrax in humans and animals. 1998.Search in Google Scholar

16. Lee JH, Park Y, Choi JR, Lee EK, Kim HS. Comparisons of three automated systems for genomic DNA extraction in a clinical diagnostic laboratory. Yonsei Med J 2010;51:104–10.10.3349/ymj.2010.51.1.104Search in Google Scholar PubMed PubMed Central

17. Kuske CR, Banton KL, Adorada DL, Stark PC, Hill KK, Jackson PJ. Small-scale DNA sample preparation method for field PCR detection of microbial cells and spores in soil. Appl Environ Microbiol 1998;64:2463–72.10.1128/AEM.64.7.2463-2472.1998Search in Google Scholar PubMed PubMed Central

18. Setlow P. Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. J Appl Microbiol 2006;101:514–25.10.1111/j.1365-2672.2005.02736.xSearch in Google Scholar PubMed

19. Rose R, Setlow B, Monroe A, Mallozzi M, Driks A, Setlow P. Comparison of the properties of Bacillus subtilis spores made in liquid or on agar plates. J Appl Microbiol 2007;103:691–9.10.1111/j.1365-2672.2007.03297.xSearch in Google Scholar PubMed

Received: 2018-08-17
Accepted: 2018-10-10
Published Online: 2019-06-20

©2019 Walter de Gruyter GmbH, Berlin/Boston

Articles in the same Issue

  1. Frontmatter
  2. Review Article
  3. Measurement uncertainty in laboratory medicine: the bridge between medical and industrial metrology
  4. Short Communication
  5. Investigation of beta globin gene mutations in Syrian refugee patients with thalassemia major
  6. Research Articles
  7. A practical ID-LC-MS/MS method for the most commonly analyzed steroid hormones in clinical laboratories
  8. Distribution of drug-metabolizing enzymes coding genes CYP2D6, CYP3A4, CYP3A5 alleles in a group of healthy Turkish population
  9. Molecular detection of Bacillus anthracis: evaluation of the efficiency of DNA extraction and a novel dry PCR
  10. Serum and cord blood-methylated arginine levels in gestational diabetic subjects
  11. Association of oxidative stress marker ischemia modified albumin and polycystic ovary syndrome in adolescent and young girls
  12. Influence of pegylated interferon and ribavirin on insulin resistance and metabolic factors in chronic hepatitis C
  13. Importance of biochemical parameters in order to predict clinical severity in patients diagnosed with Crimean-Congo haemorrhagic fever
  14. Evaluation of plasma VEGF and sVEGFR-1 levels in patients with diabetes mellitus receiving insulin treatment
  15. The effect of Ramadan fasting on renal functions in patients with chronic kidney disease
  16. Effect of food azo-dye tartrazine on physiological functions of pancreas and glucose homeostasis
  17. Ameliorating oxidative stress and inflammation by Hesperidin and vitamin E in doxorubicin induced cardiomyopathy
  18. Alteration in cholinesterases, γ-aminobutyric acid and serotonin level with respect to thiamine deficiency in Swiss mice
  19. Case Report
  20. Discordant troponin I value in a young woman: a case report with review of literature
  21. Letter to the editor
  22. Vitamin D test results in a public hospital in mid-January
https://doi.org/10.1515/tjb-2018-0292
Keywords for this article
Bacillus anthracis; Vegetative form; Spore form; DNA extraction; Dry PCR

Articles in the same Issue

  1. Frontmatter
  2. Review Article
  3. Measurement uncertainty in laboratory medicine: the bridge between medical and industrial metrology
  4. Short Communication
  5. Investigation of beta globin gene mutations in Syrian refugee patients with thalassemia major
  6. Research Articles
  7. A practical ID-LC-MS/MS method for the most commonly analyzed steroid hormones in clinical laboratories
  8. Distribution of drug-metabolizing enzymes coding genes CYP2D6, CYP3A4, CYP3A5 alleles in a group of healthy Turkish population
  9. Molecular detection of Bacillus anthracis: evaluation of the efficiency of DNA extraction and a novel dry PCR
  10. Serum and cord blood-methylated arginine levels in gestational diabetic subjects
  11. Association of oxidative stress marker ischemia modified albumin and polycystic ovary syndrome in adolescent and young girls
  12. Influence of pegylated interferon and ribavirin on insulin resistance and metabolic factors in chronic hepatitis C
  13. Importance of biochemical parameters in order to predict clinical severity in patients diagnosed with Crimean-Congo haemorrhagic fever
  14. Evaluation of plasma VEGF and sVEGFR-1 levels in patients with diabetes mellitus receiving insulin treatment
  15. The effect of Ramadan fasting on renal functions in patients with chronic kidney disease
  16. Effect of food azo-dye tartrazine on physiological functions of pancreas and glucose homeostasis
  17. Ameliorating oxidative stress and inflammation by Hesperidin and vitamin E in doxorubicin induced cardiomyopathy
  18. Alteration in cholinesterases, γ-aminobutyric acid and serotonin level with respect to thiamine deficiency in Swiss mice
  19. Case Report
  20. Discordant troponin I value in a young woman: a case report with review of literature
  21. Letter to the editor
  22. Vitamin D test results in a public hospital in mid-January
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 9.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/tjb-2018-0292/html
Scroll to top button