Electrochemical aptasensors for detection of small molecules, macromolecules, and cells
-
Kun Han
Kun Han received his MS in biochemistry and molecular biology (2009) and BS in biology (2005) from Nanjing University, P.R. China. Currently, he is a PhD candidate in the University of Chinese Academy of Sciences and Associate Professor in CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology. His research interests are in the fields of nanomaterial-based biosensors and their clinical applications.
Tao Liu received his MS in Biochemistry and Molecular Biology (2010) from Nanjing University, P.R. China. He is now an Assistant Professor in CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences. His research interests mainly focus on electrochemical biosensors, nanobiology, and
in vitro diagnosis.Yuanhong Wang is an instructor in the Center of Analysis and Testing, Institute of Analytical Chemistry for Life Science, Nantong University. She received her MS in the College of Engineering from Idaho State University in 2002. She is studying for a doctoral degree in the College of Chemistry, Chemical and Materials Science, Soochow University. She majors in nanoparticle modified electrode and electroanalytical chemistry.
Peng Miao obtained his BS and MS in Biochemistry at Nanjing University in 2008 and 2011, respectively. He received his PhD in Biophysics at the University of Chinese Academy of Sciences in 2016. He is now an Associate Professor in CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences. His research interests include electrochemical biosensing, bioelectrochemistry, and biophotonics based on nanostructured materials and DNA nanotechnology.
Abstract
Aptamers are a kind of special nucleic acids that have the ability to bind various targets (e.g. small molecules, macromolecules, and cells) with high affinity and specificity. As a type of efficient recognition component in analytical designs and applications, aptamers have gained intense achievements in the designs of biosensors. Especially, the past few years have witnessed the fast development of electrochemical aptasensors. In this mini-review, we summarize recent progresses in electrochemical biosensors based on aptamers. Different targets and the corresponding detection principles are introduced. The methods to enhance detectable signals are mentioned including the employment of nanomaterials. Also, some possible limitations and future perspectives are discussed.
Introduction
Nucleic acids belong to biological polymers that possess the functions of genetic information propagation and storage (de Jong et al. 2001). Besides acting as hereditary materials, artificial nucleic acids named as aptamers have been selected and synthesized as bio-elements for recognition purposes (Hermann and Patel 2000). Usually, aptamers are short, single-stranded DNA/RNA oligonucleotides that can fold into certain three-dimensional conformations for recognition, which are selected by an in vitro selection and amplification technique (systematic evolution of ligands by exponential enrichment, SELEX) (Li et al. 2014, Wu et al. 2015, Zhu et al. 2015b). Table 1 lists some examples of targets and corresponding aptamer sequences. So far, many techniques have been developed to select aptamers such as capillary electrophoresis (Yunusov et al. 2009), magnetic bead-assisted SELEX (Tok and Fischer 2008), whole-cell SELEX (Cerchia et al. 2005), capture SELEX coupled with surface plasmon resonance (SPR) (Spiga et al. 2015), microfluidic-based SELEX (Lin et al. 2014), and so on. Detailed information about binding sites and preferences for the targets can be obtained by performing high-throughput sequencing of SELEX pools (Dupont et al. 2015).
Examples of various targets and corresponding aptamers.
| Target | Aptamer sequence (5′-3′) | Ref. |
|---|---|---|
| Small molecules | ||
| Zn2+ | GGGAGAGGAUACUACUGUCAUACGUUAGGCUGUAGGCGAGGUGAAAUGAGCGGUAAUAGCCUCAGCGUAGCAUAUGCAUGAAUUCGAAGCUUCGC | (Ciesiolka et al. 1995) |
| As3+ | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCGAGATAGTAAGTGCAATCT | (Song et al. 2016) |
| Pb2+ | GGTTGGTGTGGTTGG | (Lei et al. 2015) |
| Cholic acid | AGCGCCGATTGACCCAAATCGTTTTGTATGCAAAAGCGCT | (Kato et al. 2000) |
| ATP | ACCTTCCTGGGGGAGTATTGCGGAGGAAGGT | (He et al. 2011) |
| Ochratoxin A | CGGGTGTGGGTGCCTTGATCCAGGGAGTCTCTAATC | (Soh et al. 2015) |
| Cocaine | GGGAGACAAGGAAAATCCTTCAATGAAGTGGGTCGACA | (Soh et al. 2015) |
| Estradiol | GCTTCCAGCTTATTGAATTACACGCAGAGGGTAGCGGCTCTGCGCATTCAATTGCTGCGCGCTGAAGCGCGGAAGC | (Soh et al. 2015) |
| Chloramphenicol | ACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGTAG | (Mehta et al. 2011) |
| Macromolecules | ||
| TNF-α | TGGTGGATGGCGCAGTCGGCGACAA | (Orava et al. 2013) |
| CRP | GCCUGUAAGGUGGUCGGUGUGGCGAGUGUGUUAGGAGAGAUUGC | (Wang et al. 2011) |
| Thrombin | AGTCCGTGGTAGGGCAGGTTGGGGTGACT | (Jung et al. 2013) |
| p53 Protein mutant | ATTAGCGCATTTTAACATAGGGTGC | (Chen et al. 2015) |
| PDGF | CAGGCTACGGCACGTAGAGCATCACCATGATCCTG | (Ruslinda et al. 2012) |
| VEGF | ATACCAGTCTATTCAATTGGGCCCGTCCGTATGGTGGGTGTGCTGGCCAGATAGTATGTGCAATCA | (Kaur and Yung 2012) |
| Cells | ||
| CCRF-CEM cells | ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA | (Shangguan et al. 2006) |
| CD44+ cells | GGGAUGGAUCCAAGCUUACUGGCAUCUGGAUUUGCGCGUGCCAGAAUAAAGAGUAUAACGUGUGAAUGGGAAGCUUCGAUAGGAAUUCGG | (Ababneh et al. 2013) |
| CD133+ cells | CAGAACGUAUACUAUUCUG | (Shigdar et al. 2013) |
| MEAR cells | ACAGCATCCCCATGTGAACAATCGCATTGTGATTGTTACGGTTTCCGCCTCATGGACGTGCTG | (Shangguan et al. 2008) |
| HL60 cells | ATCCAGAGTGACGCAGCATGCCCTAGTTACTACTACTCTTTTTAGCAAACGCCCTCGCTTTGGACACGGTGGCTTAGT | (Sefah et al. 2009) |
| PL45 cells | CGCTCGGATGCCACTACAGTGCTAATCTCAAGGGTCGTTCCCGATCACCGAGTCTGAGGCTGG | (Champanhac et al. 2015) |
Aptamers endowed with functional groups that mimic amino acid side chains can expand the chemical diversity (Gold et al. 2010, Rohloff et al. 2014). The resulting modified aptamers create unique intramolecular motifs and can contact with proteins directly. Nucleic acid-based ligands and protein-based ligands can then be substantially bridged. Aptamers have high affinity towards a variety of target analytes, including small molecules (Huizenga and Szostak 1995, Radi and O’Sullivan 2006), macromolecules like proteins (Pavlov et al. 2004, Centi et al. 2007), and even whole cells (Farokhzad et al. 2004, Smith et al. 2007). The binding affinity of aptamers and targets rivals that of antibodies and antigens. One of the most remarkable structural characteristics of nucleic acids is the specific base pairing, which helps the design of various aptamer sensors. Additionally, many other favorable characteristics, such as ease of synthesis and isolation, low cost, high resistance against denaturation, small size, and low immunogenicity (Cansiz et al. 2015, Lao et al. 2015, Roy et al. 2015), make aptamers promising candidates for further applications, which are developing rapidly (Han et al. 2010, Zhu et al. 2015a, Kim et al. 2016).
Considering the antibody-like affinity to biomolecules, aptamers are taken into several promising researches. Aptamers can be employed for delivery and then controlled release of targets like small interfering RNAs to improve corresponding therapeutic efficacy and safety (McNamara et al. 2006, Zhang et al. 2015). Wang et al. (2015a) designed a closed-loop aptamer to inhibit thrombin activity, which can be restored with near-infrared light to increase solution temperature and then disrupt the closed-loop structures using gold nanorods as photothermal agents. This aptamer-based strategy for protein activity regulation may have broad applications in biological mechanisms study.
Aptamers, taken as recognition elements, are playing important roles in the design of colorimetric, fluorescent, quartz crystal microbalance, SPR, and electrochemical biosensors (Vance and Sandros 2014, Kavosi et al. 2015, Osypova et al. 2015, Qiu et al. 2015, Wang et al. 2015b, Zhao et al. 2015). Among all these techniques, electrochemical methods are widely incorporated with aptamers-based target recognition due to their advantages such as well-developed theory, facile design, low cost, high sensitivity, easy operation, and so on (Miao et al. 2015a, Dixit et al. 2016). So far, different kinds of electrochemical aptasensors have been developed, which have wide applications for various analytical purposes. Additionally, the employment of nanomaterials like graphene oxide may further assist or improve the analysis (Erdem et al. 2015, Gao et al. 2015).
Herein, in this mini-review, we mainly focus on recent advances in aptamer-based electrochemical biosensors for the detection of small molecules, macromolecules, and cells. Their analytical performances and unique features are introduced. The limitations and future development are also discussed.
Electrochemical aptasensors for small molecules analysis
Small molecules such as ions (Nguyen et al. 2014), ATP (Jia et al. 2015), and hydrogen peroxide (H2O2) (Miao et al. 2015b) have a diversity of physiological and pathological effects, and their aberrant levels have been found to be significantly indicative in various clinical diagnoses.
Miao et al. (2014) developed a K+ aptasensor utilizing the digestion reaction of RecJf exonuclease. A single DNA probe with stem-loop structure was designed and located on the gold electrode through covalent thiol-gold bonds. The probe contained an anti-K+ aptamer sequence, which formed a G-quadruplex structure in the presence of K+. As shown in Figure 1, the destruction of stem-loop facilitated the release of free 5′ end of the DNA probe, which can be further recognized and digested by RecJf exonuclease (Wu et al. 2014). As the reaction proceeded, K+ was returned back to the solution and could bind to another DNA probe with stem-loop structure on the electrode, initiating a new cycle of cleavage. Due to the loss of the electrochemical species (methylene blue, MB), which were labeled on the DNA probe, the signal declined sharply, which could be used to evaluate the concentration of K+. This aptasensor achieved linear detection range from 50 nm to 1 mm and a detection limit of 50 nm. Moreover, other interfering cations such as Na+, Ag+, Ca2+, Fe2+, Fe3+, Zn2+, and Al3+ could be successfully distinguished with little change of the current peak. The limitation was that the aptasensor could not be reused since the DNA probe was digested by exonuclease.
Scheme of the K+ aptasensor based on RecJf exonuclease cleavage.
Reproduced by permission of The Royal Society of Chemistry.
Ochratoxin A (OTA) is one of the most abundant food-contaminating mycotoxins, which is potentially carcinogenic to humans (Giovannoli et al. 2015, Lee and Ryu 2015). Marty’s group realized sensitive analysis of OTA by an aptasensor using differential pulse voltammetry (Mishra et al. 2016). A competition strategy was employed. Free OTA to be detected competed with biotin-labeled OTA to bind with aptamer which was previously modified on the screen-printed carbon electrode. After adding avidin-ALP to generate signals, the percentage of free OTA binding event could be calculated. This aptasensor showed a good linear range from 0.15 to 5 ng/ml with the detection limit of 0.07 ng/ml. It could be further integrated into portable systems for wider applications.
Mao et al. (2015) fabricated an electrochemical biosensing method for ATP analysis based on triple helix forming strategy. Three DNA probes were involved: a signal transduction probe (STP) with the modification of 5′ end MB and 3′ end SH; an aptamer for ATP; and a triplex-forming oligonucleotide probe (Wang et al. 2015d). The three probes contained partial complementary sequences self-assembled on the electrode. MB molecules were distal to the electrode surface; thus, electron transfer (eT) OFF state was exhibited. After the introduction of ATP, the aptamer binded to ATP, and the MB end of STP was liberated and folded back to form a triplex-helix structure. In this case, MB molecules were very close to the electrode surface, and eT ON state was achieved. This simple strategy allowed the detection of ATP with the concentration as low as 7.2 nm and can be extended to detect other targets like thrombin.
Feng et al. (2015) split aptamers and applied sandwich structure to detect ATP. First, ATP aptamer was divided into two parts, and the electrode was modified with only a 14-mer split aptamer. Another 13-mer split aptamer strand was modified with a ferrocene (Fc) tag. It could be localized onto the electrode surface in the presence of ATP, which helped the formation of the sandwich structure. However, this split strategy depended on the aptamer sequence, which could not be extended to detect other targets directly. Due to the fact that ATP-aptamer complex could be dissociated by adenosine deaminase, which efficiently catalyzed the deamination of adenosine (deoxyadenosine) into inosine (deoxyinosine), an inhibit logic gate was operated.
Electrochemical aptasensors for macromolecule analysis
The need for the development of macromolecule biosensors is continuously increasing since macromolecule analysis such as C-reactive protein (CRP) (Eid et al. 2015), matrix metalloproteinase (Lee et al. 2015), and endotoxin (Miao 2013) are important in aspects of public health and food safety. However, selective recognition elements for macromolecules are always difficult to develop. The most commonly used antibodies or enzymes may be restricted to certain targets. Therefore, the development of aptasensors brings new sight for macromolecule analysis.
Thrombin is the critical enzyme in the process of hemostasis and blood coagulation, which have great clinical significance (Koo et al. 2010). Zhao et al. (2014) developed an electrochemical aptasensor for thrombin using a ligase-assisted exonuclease III (Exo III)-catalyzed reaction for signal amplification. As depicted in Figure 2, probe DNA, thrombin-binding aptamer (TBA), and extension strand (E-strand) formed double strands with a ligatable nick between TBA and E-strand, which could be ligated by the catalysis of DNA ligase. Exo III could further recognize the thermostable duplex and degrade DNA probe, releasing the ligated TBA and E-strand to hybridize with other DNA probes, triggering the next round of degradation reaction. Therefore, numerous signal outputs of MBs could be released from DNA probe that were captured by cucurbit[7]uril (CB[7])/gold nanoparticles (AuNPs)/PDDA-modified electrode.
![Figure 2: Schematic diagram for the preparation of the thrombin aptasensor based on ligase-assisted Exo III-catalyzed degradation reaction. CB [7], cucurbit[7]uril.Reprinted with permission from (Zhao et al. 2014). Copyright (2014) American Chemical Society.](/document/doi/10.1515/revac-2016-0009/asset/graphic/j_revac-2016-0009_fig_002.jpg)
Schematic diagram for the preparation of the thrombin aptasensor based on ligase-assisted Exo III-catalyzed degradation reaction. CB [7], cucurbit[7]uril.
Reprinted with permission from (Zhao et al. 2014). Copyright (2014) American Chemical Society.
Platelet-derived growth factor (PDGF-BB) is a cancer-related protein, which is involved in many cell transformation processes including tumor growth and progression (Xie et al. 2014). Recently, Song et al. (2014a) fabricated a disposable electrochemical aptasensor for protein assay. As shown in Figure 3A, they first immobilized the aptamer for PDGF-BB on AuNPs-modified screen-printed electrode (SPE). Second, a sandwich-type reaction occurred on the SPE surface employing in situ hybridization of two kinds of DNA-modified silver nanoparticles (AgNPs), which leads to AgNPs aggregate. Through stripping detection of silver after peroxidation, amplified signals could be obtained to reveal the PDGF-BB level. Moreover, SPE assay chips were tested for logic gate operation of multiple target detection. PDGF-BB and thrombin were applied as the models to demonstrate the successful fabrication of multiplexed protein measurements (Figure 3B).
Scheme of the (A) electrochemical detection and (B) multiplexed electrochemical detection of proteins.
Reprinted with permission from (Song et al. 2014a). Copyright (2014) American Chemical Society.
Tumor necrosis factor-α (TNF-α) is a type of cell-signaling protein, which plays an important role in the regulation of immune cells (Locksley et al. 2001). Dysregulation of TNF-α is implicated in a range of human diseases including cancer, Alzheimer’s disease, and so on (de Oliveira et al. 2015, Hsu et al. 2016). Mazloum-Ardakani et al. (2015) fabricated a simple label-free aptasensor for TNF-α based on the Ag@Pt core-shell nanoparticles/reduced graphene oxide (rGO). AgNPs were firstly loaded on rGO, and Pt shells were further loaded on AgNPs. The nanocomposites were demonstrated to be electrochemically enhanced materials, which were modified on gold screen printed electrodes, electrocatalyzing catechol for signal output in the aptasensor for TNF-α. Good linear range of 0–60 pg ml–1 and low detection limit (2.07 pg ml–1) were achieved.
Endotoxin, also named as lipopolysaccharide, is the major component of the outer membrane of gram-negative bacteria, which can cause a strong immune response (Raetz and Whitfield 2002). To avoid further symptoms of organ failure, shock, or even death, effective endotoxin contamination monitoring methods should be carried out (Inoue et al. 2012, Miao et al. 2013). Kim et al. (2012) tried to harness aptamers for endotoxin detection using electrochemical impedance spectroscopy. They first employed a nonequilibrium capillary electrophoresis of equilibrium mixtures (NECEEM)-based non-SELEX method to identify aptamers with nanomolar level dissociation constants. Then, they immobilized aptamer self-assembled monolayer on the electrode surface, which was used to interact with endotoxin to be detected. The sensitivity was high with femtomolar level detection limit. This developed aptasensor also had advantages of little cross-interaction reactivity to other molecules such as DNA, RNA, proteins, saccharides, and so on, which showed excellent selectivity.
Electrochemical aptasensors for cell analysis
Recently, fast analysis of cells especially cancer cells can be a critical step in disease diagnosis. To achieve the goal of early diagnosis, it is essential to apply a sensitive method for the detection of certain lesion cells (Zheng et al. 2014).
Wang et al. constructed a label-free electrochemical aptasensor for cancer cell detection with layer-by-layer assembly technology (LAL) (Wang et al. 2015c). Fc-appended poly(allylamine hydrochloride) (Fc-PAH) was a positively charged reversible redox-active probe, which was modified on the surface of graphene matrix through electrostatic interaction, forming Fc-PAH-G composites. Fc-PAH-G not only carried a number of signal probes but also promoted eT; thus, the obtained electrochemical signal could be significantly enhanced. Poly(sodium-p-styrenesulfonate) is a negatively charged polymer and functions as the linker of Fc-PAH-G through LAL (Noh et al. 2015). Aptamer was then assembled on the outmost layer of the electrode via electrostatic interaction, which formed stable G-quardruplex structure afterbound to cancer cells. The attached cells could hinder eT, and the detected current response had direct relationship with the number of adsorbed cells. This aptasensor showed good stability and high sensitivity and selectivity towards the detection of cancer cells.
A multivalent recognition strategy for electrochemical cytosensing by combining concanavalin A (Con A) and aptamer was developed (Chen et al. 2014b). Multivalent strategy has many merits over monovalent interaction, which was proved to possess enhanced affinity by a factor as large as 104–105 (Barboiu et al. 2014, Chen et al. 2014a). Con A was a mannose binding protein, which could interact with mannose or trimannoside, the core oligosaccharide of N-glycan on the cell surface (Dong et al. 2015, Idil et al. 2015). As shown in Figure 4, Chen et al. firstly coated poly(amidoamine) (PAMAM) dendrimers-conjugated rGO on a glassy carbon electrode (GCE), which could not only promote eT rate but also provide multiple groups for further Con A immobilization (Han et al. 2014, Song et al. 2014b). After cell capture by Con A, aptamer and horseradish peroxidase (HRP) dual modified AuNPs could bind to the cells, forming a sandwich structure. Electrochemical catalysis signals of hydroquinone could be largely enhanced by the huge amount of HRP on AuNPs (Rogozhin and Verkhoturov 1999). Moreover, the multivalent recognition strategy promised high selectivity and sensitivity. As low as 10 cells/ml could be detected by this aptasensor.
Schematic illustration of the cytosensor based on multivalent recognition and dual signal amplification.
Reprinted with permission from (Chen et al. 2014b). Copyright (2014) American Chemical Society.
Qu et al. also used dual-recognition elements for highly sensitive and selective detection of circulating tumor cells (CTCs) (Qu et al. 2014). CTCs shed from a primary tumor and circulate in the bloodstream. CTCs are responsible for metastases of cancer to distant organs via hematogenous dissemination (Fehm et al. 2002). They are used as clinical biomarkers for the diagnosis and prognosis of various cancers (Myung and Hong 2015, Sugimoto et al. 2015). As shown in Figure 5, two cell-specific aptamers were chosen and modified on GCE via the amide bonds. However, the links between GCE and the two aptamers were different. One was flexible using a single-stranded DNA, and the other was rigid using a double-stranded DNA. The rigid linker might have low binding to graphite and thus kept the aptamer away from GCE surface. Moreover, the linker could also help the upright stature of another linker, which had flexible structure and larger binding efficiency to cells. Additionally, cells could be recognized on the site away from GCE surface, minimizing the steric hindrance. Experimental results confirmed that the dual-aptamer modification strategy had improved sensitivity in comparison with single-aptamer modification strategy. Moreover, other advanced signal probes could be exploited. A single cell in 109 whole blood cells could be detected, making this strategy a promising potential for CTC-related clinical studies and applications.
Scheme of the dual-aptamer modified electrode interface for specific and sensitive detection of MEAR tumor cells.
Reprinted with permission from (Qu et al. 2014). Copyright (2014) American Chemical Society.
Conclusions and perspectives
This mini-review primarily focuses on recent developments in electrochemical aptasensors for the detection of small molecules, macromolecules, and cells, in which the applications of aptamers are the key points. The targets are mainly of clinical importance. Despite the attractive advantages of aptamers, more work should be done. For example, more aptamers for different targets can be selected and optimized; the mechanisms of aptamer interaction and immobilization should be studied further; novel strategy of the combination of nanomaterials and aptasensors may improve current performances; development of aptamer-based electrochemical biochip is the one option to meet the requirement of point of care test in clinical scenario; more multi-target-sensing strategies are needed; and the future development of high-throughput platform may influence the analytical performance and efficiency significantly.
Award Identifier / Grant number: 2015261
Funding source: National Natural Science Foundation of China
Award Identifier / Grant number: 31400847
Award Identifier / Grant number: 31500805
Funding statement: This work was supported by Youth Innovation Promotion Association CAS (Grant no. 2015261) and the National Natural Science Foundation of China (Grant nos. 31400847 and 31500805).
About the authors
Kun Han received his MS in biochemistry and molecular biology (2009) and BS in biology (2005) from Nanjing University, P.R. China. Currently, he is a PhD candidate in the University of Chinese Academy of Sciences and Associate Professor in CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology. His research interests are in the fields of nanomaterial-based biosensors and their clinical applications.
Tao Liu received his MS in Biochemistry and Molecular Biology (2010) from Nanjing University, P.R. China. He is now an Assistant Professor in CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences. His research interests mainly focus on electrochemical biosensors, nanobiology, and in vitro diagnosis.
Yuanhong Wang is an instructor in the Center of Analysis and Testing, Institute of Analytical Chemistry for Life Science, Nantong University. She received her MS in the College of Engineering from Idaho State University in 2002. She is studying for a doctoral degree in the College of Chemistry, Chemical and Materials Science, Soochow University. She majors in nanoparticle modified electrode and electroanalytical chemistry.
Peng Miao obtained his BS and MS in Biochemistry at Nanjing University in 2008 and 2011, respectively. He received his PhD in Biophysics at the University of Chinese Academy of Sciences in 2016. He is now an Associate Professor in CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences. His research interests include electrochemical biosensing, bioelectrochemistry, and biophotonics based on nanostructured materials and DNA nanotechnology.
Acknowledgments
This work was supported by Youth Innovation Promotion Association CAS (Grant no. 2015261) and the National Natural Science Foundation of China (Grant nos. 31400847 and 31500805).
References
Ababneh, N.; Alshaer, W.; Allozi, O.; Mahafzah, A.; El-Khateeb, M.; Hillaireau, H.; Noiray, M.; Fattal, E.; Ismail, S. In vitro selection of modified RNA aptamers against CD44 cancer stem cell marker. Nucl. Acid Ther.2013, 23, 401–407.10.1089/nat.2013.0423Suche in Google Scholar PubMed PubMed Central
Barboiu, M.; Mouline, Z.; Silion, M.; Licsandru, E.; Simionescu, B. C.; Mahon, E.; Pinteala, M. Multivalent recognition of concanavalin A by {Mo-132} glyconanocapsules – toward biomimetic hybrid multilayers. Chem. Eur. J.2014, 20, 6678–6683.10.1002/chem.201402187Suche in Google Scholar PubMed
Cansiz, S.; Zhang, L. Q.; Wu, C. C.; Wu, Y.; Teng, I. T.; Hou, W. J.; Wang, Y. Y.; Wan, S. O.; Cai, R.; Jin, C.; Liu, Q. L.; Tan, W. H. DNA aptamer based nanodrugs: molecular engineering for efficiency. Chem.-Asian J.2015, 10, 2084–2094.10.1002/asia.201500434Suche in Google Scholar PubMed PubMed Central
Centi, S.; Tombelli, S.; Minunni, M.; Mascini, M. Aptamer-based detection of plasma proteins by an electrochemical assay coupled to magnetic beads. Anal. Chem.2007, 79, 1466–1473.10.1021/ac061879pSuche in Google Scholar PubMed
Cerchia, L.; Duconge, F.; Pestourie, C.; Boulay, J.; Aissouni, Y.; Gombert, K.; Tavitian, B.; de Franciscis, V.; Libri, D. Neutralizing aptamers from whole-cell SELEX inhibit the RET receptor tyrosine kinase. PLoS. Biol.2005, 3, 697–704.10.1371/journal.pbio.0030123Suche in Google Scholar
Champanhac, C.; Teng, I. T.; Cansiz, S.; Zhang, L. Q.; Wu, X. Q.; Zhoa, Z. L.; Fu, T.; Tan, W. H. Development of a panel of DNA aptamers with high affinity for pancreatic ductal adenocarcinoma. Sci. Rep.2015, 5, 16788.10.1038/srep16788Suche in Google Scholar PubMed PubMed Central
Chen, X. J.; He, Y.; Zhang, Y. Y.; Liu, M. L.; Liu, Y.; Li, J. H. Ultrasensitive detection of cancer cells and glycan expression profiling based on a multivalent recognition and alkaline phosphatase-responsive electrogenerated chemiluminescence biosensor. Nanoscale2014a, 6, 11196–11203.10.1039/C4NR03053BSuche in Google Scholar
Chen, X. J.; Wang, Y. Z.; Zhang, Y. Y.; Chen, Z. H.; Liu, Y.; Li, Z. L.; Li, J. H. Sensitive electrochemical aptamer biosensor for dynamic cell surface n-glycan evaluation featuring multivalent recognition and signal amplification on a dendrimer-graphene electrode interface. Anal. Chem.2014b, 86, 4278–4286.10.1021/ac404070mSuche in Google Scholar PubMed
Chen, L.; Rashid, F.; Shah, A.; Awan, H. M.; Wu, M. M.; Liu, A.; Wang, J.; Zhu, T.; Luo, Z. F.; Shan, G. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation. Proc. Natl. Acad. Sci. USA2015, 112, 10002–10007.10.1073/pnas.1502159112Suche in Google Scholar PubMed PubMed Central
Ciesiolka, J.; Gorski, J.; Yarus, M. Selection of an RNA domain that binds Zn2+. RNA-Publ. RNA Soc.1995, 1, 538–550.Suche in Google Scholar
de Jong, P.; Catanese, J. J.; Osoegawa, K.; Shizuya, H.; Choi, S.; Chen, Y. J.; Cons, I. H. G. S. Initial sequencing and analysis of the human genome. Nature2001, 412, 565–566.10.1038/35087627Suche in Google Scholar
de Oliveira, J. G.; Rossi, A. F. T.; Nizato, D. M.; Cadamuro, A. C. T.; Jorge, Y. C.; Valsechi, M. C.; Venancio, L. P. R.; Rahal, P.; Pavarino, E. C.; Goloni-Bertollo, E. M.; Silva, A. E. Influence of functional polymorphisms in TNF-alpha, IL-8, and IL-10 cytokine genes on mRNA expression levels and risk of gastric cancer. Tumor Biol.2015, 36, 9159–9170.10.1007/s13277-015-3593-xSuche in Google Scholar PubMed
Dixit, C. K.; Kadimisetty, K.; Otieno, B. A.; Tang, C.; Malla, S.; Krause, C. E.; Rusling, J. F. Electrochemistry-based approaches to low cost, high sensitivity, automated, multiplexed protein immunoassays for cancer diagnostics. Analyst2016, 141, 536–547.10.1039/C5AN01829CSuche in Google Scholar
Dong, L. P.; Feng, S.; Li, S. S.; Song, P. P.; Wang, J. D. Preparation of concanavalin A-chelating magnetic nanoparticles for selective enrichment of glycoproteins. Anal. Chem.2015, 87, 6849–6853.10.1021/acs.analchem.5b01184Suche in Google Scholar PubMed
Dupont, D. M.; Larsen, N.; Jensen, J. K.; Andreasen, P. A.; Kjems, J. Characterisation of aptamer-target interactions by branched selection and high-throughput sequencing of SELEX pools. Nucleic Acids Res.2015, 43, e139.10.1093/nar/gkv700Suche in Google Scholar PubMed PubMed Central
Eid, C.; Palko, J. W.; Katilius, E.; Santiago, J. G. Rapid slow off-rate modified aptamer (SOMAmer)-based detection of C-reactive protein using isotachophoresis and an ionic spacer. Anal. Chem.2015, 87, 6736–6743.10.1021/acs.analchem.5b00886Suche in Google Scholar PubMed
Erdem, A.; Congur, G.; Mayer, G. Aptasensor platform based on carbon nanofibers enriched screen printed electrodes for impedimetric detection of thrombin. J. Electroanal. Chem.2015, 758, 12–19.10.1016/j.jelechem.2015.10.002Suche in Google Scholar
Farokhzad, O. C.; Jon, S. Y.; Khademhosseini, A.; Tran, T. N. T.; LaVan, D. A.; Langer, R. Nanopartide-aptamer bioconjugates: a new approach for targeting prostate cancer cells. Cancer Res.2004, 64, 7668–7672.10.1158/0008-5472.CAN-04-2550Suche in Google Scholar PubMed
Fehm, T.; Sagalowsky, A.; Clifford, E.; Beitsch, P.; Saboorian, H.; Euhus, D.; Meng, S. D.; Morrison, L.; Tucker, T.; Lane, N.; Ghadimi, B. M.; Heselmeyer-Haddad, K.; Ried, T.; Rao, C.; Uhr, J. Cytogenetic evidence that circulating epithelial cells in patients with carcinoma are malignant. Clin. Cancer Res.2002, 8, 2073–2084.Suche in Google Scholar
Feng, L. Y.; Lyu, Z. Z.; Offenhausser, A.; Mayer, D. Multi-level logic gate operation based on amplified aptasensor performance. Angew. Chem. Int. Ed.2015, 54, 7693–7697.10.1002/anie.201502315Suche in Google Scholar PubMed
Gao, L.; Li, Q.; Li, R. Q.; Yan, L. R.; Zhou, Y.; Chena, K. P.; Shi, H. X. Highly sensitive detection for proteins using graphene oxide-aptamer based sensors. Nanoscale2015, 7, 10903–10907.10.1039/C5NR01187FSuche in Google Scholar PubMed
Giovannoli, C.; Passini, C.; Volpi, G.; Di Nardo, F.; Anfossi, L.; Baggiani, C. Peptide-based affinity media for solid-phase extraction of ochratoxin A from wine samples: effect of the solid support on binding properties. Talanta2015, 144, 496–501.10.1016/j.talanta.2015.06.007Suche in Google Scholar PubMed
Gold, L.; Ayers, D.; Bertino, J.; Bock, C.; Bock, A.; Brody, E. N.; Carter, J.; Dalby, A. B.; Eaton, B. E.; Fitzwater, T.; Flather, D.; Forbes, A.; Foreman, T.; Fowler, C.; Gawande, B.; Goss, M.; Gunn, M.; Gupta, S.; Halladay, D.; Heil, J.; Heilig, J.; Hicke, B.; Husar, G.; Janjic, J.; Jarvis, T.; Jennings, S.; Katilius, E.; Keeney, T. R.; Kim, N.; Koch, T. H.; Kraemer, S.; Kroiss, L.; Le, N.; Levine, D.; Lindsey, W.; Lollo, B.; Mayfield, W.; Mehan, M.; Mehler, R.; Nelson, S. K.; Nelson, M.; Nieuwlandt, D.; Nikrad, M.; Ochsner, U.; Ostroff, R. M.; Otis, M.; Parker, T.; Pietrasiewicz, S.; Resnicow, D. I.; Rohloff, J.; Sanders, G.; Sattin, S.; Schneider, D.; Singer, B.; Stanton, M.; Sterkel, A.; Stewart, A.; Stratford, S.; Vaught, J. D.; Vrkljan, M.; Walker, J. J.; Watrobka, M.; Waugh, S.; Weiss, A.; Wilcox, S. K.; Wolfson, A.; Wolk, S. K.; Zhang, C.; Zichi, D. Aptamer-based multiplexed proteomic technology for biomarker discovery. PLoS One2010, 5, e15004.10.1371/journal.pone.0015004Suche in Google Scholar PubMed PubMed Central
Han, K.; Liang, Z. Q.; Zhou, N. D. Design strategies for aptamer-based biosensors. Sensors2010, 10, 4541–4557.10.3390/s100504541Suche in Google Scholar PubMed PubMed Central
Han, K.; Miao, P.; Tong, H.; Liu, T.; Cheng, W. B.; Zhu, X. L.; Tang, Y. G. Preparation of silver nanoparticles/graphene nanosheets as a catalyst for electrochemical oxidation of methanol. Appl. Phys. Lett.2014, 104, 053101.10.1063/1.4863662Suche in Google Scholar
He, Y.; Wang, Z. G.; Tang, H. W.; Pang, D. W. Low background signal platform for the detection of ATP: when a molecular aptamer beacon meets graphene oxide. Biosens. Bioelectron.2011, 29, 76–81.10.1016/j.bios.2011.07.069Suche in Google Scholar PubMed
Hermann, T.; Patel, D. J. Biochemistry – adaptive recognition by nucleic acid aptamers. Science2000, 287, 820–825.10.1126/science.287.5454.820Suche in Google Scholar PubMed
Hsu, K. S.; Guan, B. J.; Cheng, X.; Guan, D.; Lam, M.; Hatzoglou, M.; Kao, H. Y. Translational control of PML contributes to TNF alpha-induced apoptosis of MCF7 breast cancer cells and decreased angiogenesis in HUVECs. Cell Death Differ.2016, 23, 469–483.10.1038/cdd.2015.114Suche in Google Scholar PubMed PubMed Central
Huizenga, D. E.; Szostak, J. W. A DNA aptamer that binds adenosine and ATP. Biochemistry1995, 34, 656–665.10.1021/bi00002a033Suche in Google Scholar PubMed
Idil, N.; Percin, I.; Karakoc, V.; Yavuz, H.; Aksoz, N.; Denizli, A. Concanavalin A immobilized magnetic poly(glycidyl methacrylate) beads for prostate specific antigen binding. Colloid Surf. B-Biointerfaces2015, 134, 461–468.10.1016/j.colsurfb.2015.06.050Suche in Google Scholar PubMed
Inoue, K. Y.; Takahashi, S.; Ino, K.; Shiku, H.; Matsue, T. Development of an electrochemical limulus amebocyte lysate assay technique for portable and highly sensitive endotoxin sensor. Innate Immun.2012, 18, 343–349.10.1177/1753425911410337Suche in Google Scholar PubMed
Jia, L.; Ding, L.; Tian, J. W.; Bao, L.; Hu, Y. P.; Ju, H. X.; Yu, J. S. Aptamer loaded MoS2 nanoplates as nanoprobes for detection of intracellular ATP and controllable photodynamic therapy. Nanoscale2015, 7, 15953–15961.10.1039/C5NR02224JSuche in Google Scholar PubMed
Jung, Y. K.; Lee, T.; Shin, E.; Kim, B. S. Highly tunable aptasensing microarrays with graphene oxide multilayers. Sci. Rep.2013, 3, 3367.10.1038/srep03367Suche in Google Scholar PubMed PubMed Central
Kato, T.; Yano, K.; Ikebukuro, K.; Karube, I. Interaction of three-way DNA junctions with steroids. Nucleic Acids Res.2000, 28, 1963–1968.10.1093/nar/28.9.1963Suche in Google Scholar PubMed PubMed Central
Kaur, H.; Yung, L. Y. L. Probing high affinity sequences of DNA aptamer against VEGF165. PLos One2012, 7, e31196.10.1371/journal.pone.0031196Suche in Google Scholar PubMed PubMed Central
Kavosi, B.; Salimi, A.; Hallaj, R.; Moradi, F. Ultrasensitive electrochemical immunosensor for PSA biomarker detection in prostate cancer cells using gold nanoparticles/PAMAM dendrimer loaded with enzyme linked aptamer as integrated triple signal amplification strategy. Biosens. Bioelectron.2015, 74, 915–923.10.1016/j.bios.2015.07.064Suche in Google Scholar PubMed
Kim, S. E.; Su, W.; Cho, M.; Lee, Y.; Choe, W. S. Harnessing aptamers for electrochemical detection of endotoxin. Anal. Biochem.2012, 424, 12–20.10.1016/j.ab.2012.02.016Suche in Google Scholar PubMed
Kim, Y. S.; Raston, N. H. A.; Gu, M. B. Aptamer-based nanobiosensors. Biosens. Bioelectron.2016, 76, 2–19.10.1016/j.bios.2015.06.040Suche in Google Scholar PubMed
Koo, B. H.; Han, J. H.; Il Yeom, Y.; Kim, D. S. Thrombin-dependent MMP-2 activity is regulated by heparan sulfate. J. Biol. Chem.2010, 285, 41270–41279.10.1074/jbc.M110.171595Suche in Google Scholar PubMed PubMed Central
Lao, Y. H.; Phua, K. K. L.; Leong, K. W. Aptamer nanomedicine for cancer therapeutics: barriers and potential for translation. ACS Nano2015, 9, 2235–2254.10.1021/nn507494pSuche in Google Scholar PubMed
Lee, H. J.; Ryu, D. Significance of ochratoxin A in breakfast cereals from the United States. J. Agric. Food Chem.2015, 63, 9404–9409.10.1021/jf505674vSuche in Google Scholar PubMed
Lee, S. E.; Chen, Q.; Bhat, R.; Petkiewicz, S.; Smith, J. M.; Ferry, V. E.; Correia, A. L.; Alivisatos, A. P.; Bissell, M. J. Reversible aptamer-Au plasmon rulers for secreted single molecules. Nano Lett.2015, 15, 4564–4570.10.1021/acs.nanolett.5b01161Suche in Google Scholar PubMed PubMed Central
Lei, Y. M.; Huang, W. X.; Zhao, M.; Chai, Y. Q.; Yuan, R.; Zhuo, Y. Electrochemiluminescence resonance energy transfer system: mechanism and application in ratiometric aptasensor for lead ion. Anal. Chem.2015, 87, 7787–7794.10.1021/acs.analchem.5b01445Suche in Google Scholar PubMed
Li, J. J.; You, J.; Zhuang, Y. P.; Han, C. P.; Hu, J. F.; Wang, A.; Xu, K.; Zhu, J. J. A “light-up” and “spectrum-shift” response of aptamer-functionalized silver nanoclusters for intracellular mRNA imaging. Chem. Commun.2014, 50, 7107–7110.10.1039/c4cc00160eSuche in Google Scholar
Lin, H.; Zhang, W. T.; Jia, S. S.; Guan, Z. C.; Yang, C. J.; Zhu, Z. Microfluidic approaches to rapid and efficient aptamer selection. Biomicrofluidics2014, 8, 041501.10.1063/1.4890542Suche in Google Scholar
Locksley, R. M.; Killeen, N.; Lenardo, M. J. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell2001, 104, 487–501.10.1016/S0092-8674(01)00237-9Suche in Google Scholar
Mao, Y. F.; Liu, J. Q.; He, D. G.; He, X. X.; Wang, K. M.; Shi, H.; Wen, L. Aptamer/target binding-induced triple helix forming for signal-on electrochemical biosensing. Talanta2015, 143, 381–387.10.1016/j.talanta.2015.05.009Suche in Google Scholar PubMed
Mazloum-Ardakani, M.; Hosseinzadeh, L.; Taleat, Z. Synthesis and electrocatalytic effect of Ag@Pt core-shell nanoparticles supported on reduced graphene oxide for sensitive and simple label-free electrochemical aptasensor. Biosens. Bioelectron.2015, 74, 30–36.10.1016/j.bios.2015.05.072Suche in Google Scholar PubMed
McNamara, J. O.; Andrechek, E. R.; Wang, Y.; Viles K. D.; Rempel, R. E.; Gilboa, E.; Sullenger, B. A.; Giangrande, P. H. Cell type-specific delivery of siRNAs with aptamer-siRNA chimeras. Nat. Biotechnol.2006, 24, 1005–1015.10.1038/nbt1223Suche in Google Scholar PubMed
Mehta, J.; Van Dorst, B.; Rouah-Martin, E.; Herrebout, W.; Scippo, M. L.; Blust, R.; Robbens, J. In vitro selection and characterization of DNA aptamers recognizing chloramphenicol. J. Biotechnol.2011, 155, 361–369.10.1016/j.jbiotec.2011.06.043Suche in Google Scholar PubMed
Miao, P. Electrochemical sensing strategies for the detection of endotoxin: a review. RSC Adv.2013, 3, 9606–9617.10.1039/c3ra00047hSuche in Google Scholar
Miao, P.; Han, K.; Qi, J.; Zhang, C.; Liu, T. Electrochemical investigation of endotoxin induced limulus amebocyte lysate gel-clot process. Electrochem. Commun.2013, 26, 29–32.10.1016/j.elecom.2012.10.002Suche in Google Scholar
Miao, P.; Tang, Y. G.; Wang, B. D.; Han, K.; Chen, X. F.; Sun, H. X. An aptasensor for detection of potassium ions based on RecJ(f) exonuclease mediated signal amplification. Analyst2014, 139, 5695–5699.10.1039/C4AN01350FSuche in Google Scholar
Miao, P.; Tang, Y. G.; Yin, J. MicroRNA detection based on analyte triggered nanoparticle localization on a tetrahedral DNA modified electrode followed by hybridization chain reaction dual amplification. Chem. Commun.2015a, 51, 15629–15632.10.1039/C5CC05499KSuche in Google Scholar
Miao, P.; Wang, B. D.; Yin, J.; Chen, X. F.; Tang, Y. G. Electrochemical tracking hydrogen peroxide secretion in live cells based on autocatalytic oxidation reaction of silver nanoparticles. Electrochem. Commun.2015b, 53, 37–40.10.1016/j.elecom.2015.02.007Suche in Google Scholar
Mishra, R. K.; Hayat, A.; Catanante, G.; Istamboulie, G.; Marty, J. L. Sensitive quantitation of Ochratoxin A in cocoa beans using differential pulse voltammetry based aptasensor. Food Chem.2016, 192, 799–804.10.1016/j.foodchem.2015.07.080Suche in Google Scholar PubMed
Myung, J. H.; Hong, S. Microfluidic devices to enrich and isolate circulating tumor cells. Lab Chip2015, 15, 4500–4511.10.1039/C5LC00947BSuche in Google Scholar PubMed PubMed Central
Nguyen, B. L.; Jeong, J. E.; Jung, I. H.; Kim, B.; Le, V. S.; Kim, I.; Kyhm, K.; Woo, H. Y. Conjugated polyelectrolyte and aptamer based potassium assay via single- and two-step fluorescence energy transfer with a tunable dynamic detection range. Adv. Funct. Mater.2014, 24, 1748–1757.10.1002/adfm.201301515Suche in Google Scholar
Noh, Y. J.; Park, S. M.; Yeo, J. S.; Kim, D. Y.; Kim, S. S.; Na, S. I. Efficient PEDOT:PSS-free polymer solar cells with an easily accessible polyacrylonitrile polymer material as a novel solution-processable anode interfacial layer. ACS Appl. Mater. Interfaces2015, 7, 25032–25038.10.1021/acsami.5b07841Suche in Google Scholar PubMed
Orava, E. W.; Jarvik, N.; Shek, Y. L.; Sidhu, S. S.; Gariepy, J. A short DNA aptamer that recognizes TNF alpha and blocks its activity in vitro. ACS Chem. Biol.2013, 8, 170–178.10.1021/cb3003557Suche in Google Scholar PubMed
Osypova, A.; Thakar, D.; Dejeu, J.; Bonnet, H.; Van der Heyden, A.; Dubacheva, G. V.; Richter, R. P.; Defrancq, E.; Spinelli, N.; Coche-Guerente, L.; Labbe, P. Sensor based on aptamer folding to detect low-molecular weight analytes. Anal. Chem.2015, 87, 7566–7574.10.1021/acs.analchem.5b01736Suche in Google Scholar PubMed
Pavlov, V.; Xiao, Y.; Shlyahovsky, B.; Willner, I. Aptamer-functionalized Au nanoparticles for the amplified optical detection of thrombin. J. Am. Chem. Soc.2004, 126, 11768–11769.10.1021/ja046970uSuche in Google Scholar PubMed
Qiu, H. Z.; Liu, Z. E.; Huang, Z. J.; Chen, M.; Cai, X. H.; Weng, S. H.; Lin, X. H. Aptamer based turn-off fluorescent ATP assay using DNA concatamers. Microchim. Acta2015, 182, 2387–2393.10.1007/s00604-015-1578-5Suche in Google Scholar
Qu, L. M.; Xu, J. H.; Tan, X. F.; Liu, Z.; Xu, L. G.; Peng, R. Dual-aptamer modification generates a unique interface for highly sensitive and specific electrochemical detection of tumor cells. ACS Appl. Mater. Interfaces2014, 6, 7309–7315.10.1021/am5006783Suche in Google Scholar PubMed
Radi, A. E.; O’Sullivan, C. K. Aptamer conformational switch as sensitive electrochemical biosensor for potassium ion recognition. Chem. Commun.2006, 3432–3434.10.1039/b606804aSuche in Google Scholar PubMed
Raetz, C. R. H.; Whitfield, C. Lipopolysaccharide endotoxins. Ann. Rev. Biochem.2002, 71, 635–700.10.1146/annurev.biochem.71.110601.135414Suche in Google Scholar PubMed PubMed Central
Rogozhin, V. V.; Verkhoturov, V. V. Steady-state kinetics of combined oxidation of hydroquinone and o-dianisidine by hydrogen peroxide in the presence of horseradish peroxidase. Biochem.-Moscow1999, 64, 175–180.Suche in Google Scholar
Rohloff, J. C.; Gelinas, A. D.; Jarvis, T. C.; Ochsner, U. A.; Schneider, D. J.; Gold, L.; Janjic, N. Nucleic acid ligands with protein-like side chains: modified aptamers and their use as diagnostic and therapeutic agents. Mol. Ther.-Nucl. Acids2014, 3, e201.10.1038/mtna.2014.49Suche in Google Scholar PubMed PubMed Central
Roy, K.; Kanwar, R. K.; Kanwar, J. R. LNA aptamer based multi-modal, Fe3O4-saturated lactoferrin (Fe3O4-bLf) nanocarriers for triple positive (EpCAM, CD133, CD44) colon tumor targeting and NIR, MRI and CT imaging. Biomaterials2015, 71, 84–99.10.1016/j.biomaterials.2015.07.055Suche in Google Scholar PubMed
Ruslinda, A. R.; Penmatsa, V.; Ishii, Y.; Tajima, S.; Kawarada, H. Highly sensitive detection of platelet-derived growth factor on a functionalized diamond surface using aptamer sandwich design. Analyst2012, 137, 1692–1697.10.1039/c2an15933cSuche in Google Scholar PubMed
Sefah, K.; Tang, Z. W.; Shangguan, D. H.; Chen, H.; Lopez-Colon, D.; Li, Y.; Parekh, P.; Martin, J.; Meng, L.; Phillips, J. A.; Kim, Y. M.; Tan, W. H. Molecular recognition of acute myeloid leukemia using aptamers. Leukemia2009, 23, 235–244.10.1038/leu.2008.335Suche in Google Scholar PubMed PubMed Central
Shangguan, D.; Li, Y.; Tang, Z. W.; Cao, Z. H. C.; Chen, H. W.; Mallikaratchy, P.; Sefah, K.; Yang, C. Y. J.; Tan, W. H. Aptamers evolved from live cells as effective molecular probes for cancer study. Proc. Natl. Acad. Sci. USA2006, 103, 11838–11843.10.1073/pnas.0602615103Suche in Google Scholar PubMed PubMed Central
Shangguan, D. H.; Meng, L.; Cao, Z. H. C.; Xiao, Z. Y.; Fang, X. H.; Li, Y.; Cardona, D.; Witek, R. P.; Liu, C.; Tan, W. H. Identification of liver cancer-specific aptamers using whole live cells. Anal. Chem.2008, 80, 721–728.10.1021/ac701962vSuche in Google Scholar PubMed
Shigdar, S.; Qiao, L.; Zhou, S. F.; Xiang, D. X.; Wang, T.; Li, Y.; Lim, L. Y.; Kong, L. X.; Li, L. H.; Duan, W. RNA aptamers targeting cancer stem cell marker CD133. Cancer Lett.2013, 330, 84–95.10.1016/j.canlet.2012.11.032Suche in Google Scholar PubMed
Smith, J. E.; Medley, C. D.; Tang, Z. W.; Shangguan, D.; Lofton, C.; Tan, W. H. Aptamer-conjugated nanoparticles for the collection and detection of multiple cancer cells. Anal. Chem.2007, 79, 3075–3082.10.1021/ac062151bSuche in Google Scholar PubMed
Soh, J. H.; Lin, Y. Y.; Rana, S.; Ying, J. Y.; Stevens, M. M. Colorimetric detection of small molecules in complex matrixes via target-mediated growth of aptamer-functionalized gold nanoparticles. Anal. Chem.2015, 87, 7644–7652.10.1021/acs.analchem.5b00875Suche in Google Scholar PubMed
Song, W.; Li, H.; Liang, H.; Qiang, W. B.; Xu, D. K. Disposable electrochemical aptasensor array by using in situ DNA hybridization inducing silver nanoparticles aggregate for signal amplification. Anal. Chem.2014a, 86, 2775–2783.10.1021/ac500011kSuche in Google Scholar PubMed
Song, Y. H.; Liu, H. Y.; Tan, H. L.; Xu, F. G.; Jia, J. B.; Zhang, L. X.; Li, Z.; Wang, L. pH-Switchable electrochemical sensing platform based on chitosan-reduced graphene oxide/concanavalin A layer for assay of glucose and urea. Anal. Chem.2014b, 86, 1980–1987.10.1021/ac402742mSuche in Google Scholar PubMed
Song, L. L.; Mao, K.; Zhou, X. D.; Hu, J. M. A novel biosensor based on Au@Ag core-shell nanoparticles for SERS detection of arsenic (III). Talanta2016, 146, 285–290.10.1016/j.talanta.2015.08.052Suche in Google Scholar PubMed
Spiga, F. M.; Maietta, P.; Guiducci, C. More DNA-aptamers for small drugs: a capture-SELEX coupled with surface plasmon resonance and high-throughput sequencing. ACS Comb. Sci.2015, 17, 326–333.10.1021/acscombsci.5b00023Suche in Google Scholar PubMed
Sugimoto, S.; Moriyama, R.; Mori, T.; Iwasaki, Y. Surface engineering of macrophages with nucleic acid aptamers for the capture of circulating tumor cells. Chem. Commun.2015, 51, 17428–17430.10.1039/C5CC06211JSuche in Google Scholar
Tok, J. B. H.; Fischer, N. O. Single microbead SELEX for efficient ssDNA aptamer generation against botulinum neurotoxin. Chem. Commun.2008, 1883–1885.10.1039/b717936gSuche in Google Scholar PubMed
Vance, S. A.; Sandros, M. G. Zeptomole detection of C-reactive protein in serum by a nanoparticle amplified surface plasmon resonance imaging aptasensor. Sci. Rep.2014, 4, 5129.10.1038/srep05129Suche in Google Scholar PubMed PubMed Central
Wang, M. S.; Black, J. C.; Knowles, M. K.; Reed, S. M. C-reactive protein (CRP) aptamer binds to monomeric but not pentameric form of CRP. Anal. Bioanal. Chem.2011, 401, 1309–1318.10.1007/s00216-011-5174-1Suche in Google Scholar PubMed PubMed Central
Wang, J.; Wei, Y. R.; Hu, X. X.; Fang, Y. Y.; Li, X. Y.; Liu, J.; Wang, S. F.; Yuan, Q. Protein activity regulation: inhibition by closed-loop aptamer-based structures and restoration by near-IR stimulation. J. Am. Chem. Soc.2015a, 137, 10576–10584.10.1021/jacs.5b04894Suche in Google Scholar PubMed
Wang, K.; Fan, D. Q.; Liu, Y. Q.; Wang, E. K. Highly sensitive and specific colorimetric detection of cancer cells via dual-aptamer target binding strategy. Biosens. Bioelectron.2015b, 73, 1–6.10.1016/j.bios.2015.05.044Suche in Google Scholar PubMed
Wang, T. S.; Liu, J. Y.; Gu, X. X.; Li, D.; Wang, J.; Wang, E. Label-free electrochemical aptasensor constructed by layer-by-layer technology for sensitive and selective detection of cancer cells. Anal. Chim. Acta2015c, 882, 32–37.10.1016/j.aca.2015.05.008Suche in Google Scholar PubMed
Wang, X. Z.; Jiang, A. W.; Hou, T.; Li, F. A versatile label-free and signal-on electrochemical biosensing platform based on triplex-forming oligonucleotide probe. Anal. Chim. Acta2015d, 890, 91–97.10.1016/j.aca.2015.06.059Suche in Google Scholar PubMed
Wu, X.; Chen, J.; Zhao, J. X. Ultrasensitive detection of 3′-5′ exonuclease enzymatic activity using molecular beacons. Analyst2014, 139, 1081–1087.10.1039/C3AN02040ASuche in Google Scholar PubMed
Wu, C. L.; Liu, J. B.; Zhang, P. F.; Li, J.; Ji, H. N.; Yang, X. H.; Wang, K. M. A recognition-before-labeling strategy for sensitive detection of lung cancer cells with a quantum dot-aptamer complex. Analyst2015, 140, 6100–6107.10.1039/C5AN01145KSuche in Google Scholar
Xie, H.; Cui, Z.; Wang, L.; Xia, Z. Y.; Hu, Y.; Xian, L. L.; Li, C. J.; Xie, L.; Crane, J.; Wan, M.; Zhen, G. H.; Bian, Q.; Yu, B.; Chang, W. Z.; Qiu, T.; Pickarski, M.; Duong, L. T.; Windle, J. J.; Luo, X. H.; Liao, E. Y.; Cao, X. PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis. Nat. Med.2014, 20, 1270–1278.10.1038/nm.3668Suche in Google Scholar PubMed PubMed Central
Yunusov, D.; So, M.; Shayan, S.; Okhonin, V.; Musheev, M. U.; Berezovski, M. V.; Krylov, S. N. Kinetic capillary electrophoresis-based affinity screening of aptamer clones. Anal. Chim. Acta2009, 631, 102–107.10.1016/j.aca.2008.10.027Suche in Google Scholar PubMed
Zhang, Y. X.; Hou, Z. Y.; Ge, Y. K.; Deng, K. R.; Liu, B.; Li, X. J.; Li, Q. S.; Cheng, Z. Y.; Ma, P. A.; Li, C. X.; Lin, J. DNA-hybrid-gated photothermal mesoporous silica nanoparticles for MR-responsive and aptamer-targeted drug delivery. ACS Appl. Mater. Interfaces2015, 7, 20696–20706.10.1021/acsami.5b05522Suche in Google Scholar PubMed
Zhao, J.; Hu, S. S.; Zhong, W. D.; Wu, J. G.; Shen, Z. M.; Chen, Z.; Li, G. X. Highly sensitive electrochemical aptasensor based on a ligase-assisted exonuclease III-catalyzed degradation reaction. ACS Appl. Mater. Interfaces2014, 6, 7070–7075.10.1021/am502053dSuche in Google Scholar PubMed
Zhao, J.; Katsube, S.; Yamamoto, J.; Yamasaki, K.; Miyagishi, M.; Iwai, S. Analysis of ATP and AMP binding to a DNA aptamer and its imidazole-tethered derivatives by surface plasmon resonance. Analyst2015, 140, 5881–5884.10.1039/C5AN01347JSuche in Google Scholar PubMed
Zheng, F. Y.; Cheng, Y.; Wang, J.; Lu, J.; Zhang, B.; Zhao, Y. J.; Gu, Z. Z. Aptamer-functionalized barcode particles for the capture and detection of multiple types of circulating tumor cells. Adv. Mater.2014, 26, 7333–7338.10.1002/adma.201403530Suche in Google Scholar PubMed
Zhu, G. Z.; Niu, G.; Chen, X. Y. Aptamer-drug conjugates. Bioconjugate Chem.2015a, 26, 2186–2197.10.1021/acs.bioconjchem.5b00291Suche in Google Scholar PubMed PubMed Central
Zhu, X. L.; Zhang, B.; Ye, Z. H.; Shi, H.; Shen, Y. L.; Li, G. X. An ATP-responsive smart gate fabricated with a graphene oxide-aptamer-nanochannel architecture. Chem. Commun.2015b, 51, 640–643.10.1039/C4CC07990FSuche in Google Scholar
©2016 Walter de Gruyter GmbH, Berlin/Boston
This article is distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Artikel in diesem Heft
- Frontmatter
- In this Issue
- Chemometrical analysis of fingerprints for the detection of counterfeit and falsified medicines
- Organic solvents in electromembrane extraction: recent insights
- Separation and characterization of environmental nano- and submicron particles
- Electrochemical aptasensors for detection of small molecules, macromolecules, and cells
Artikel in diesem Heft
- Frontmatter
- In this Issue
- Chemometrical analysis of fingerprints for the detection of counterfeit and falsified medicines
- Organic solvents in electromembrane extraction: recent insights
- Separation and characterization of environmental nano- and submicron particles
- Electrochemical aptasensors for detection of small molecules, macromolecules, and cells
