SET domain containing protein 8 (SET8) promotes tumour progression and indicates poor prognosis in patients with laryngeal squamous cell carcinoma

Clinical sample acquisition and processing

A total of 72 LSCC tumour specimens and corresponding adjacent normal tissues were obtained from patients who underwent surgical procedure, but not chemotherapy, at the Fourth Hospital of Hebei Medical University between 2014 and 2015. We obtained ethics approval from the Ethics Committee of the Fourth Hospital of Hebei Medical University (Ethic Committee NO. 2021169) in accordance with the Declaration of Helsinki (as revised in 2013), and informed consent was obtained from all patients. Tissue samples were immediately collected using RNA Latter (ComWin, Beijing, China) for subsequent RNA extraction, and the remaining samples were fixed with formalin for paraffin sectioning. Detailed patient clinical data were obtained from the medical records. Tumour stages were evaluated accordingance to the American Joint Committee on Cancer 8th edition on cancer tumour, node, metastasis (TNM) classification for LSCC [11].

Assessment of SET8 protein expression in LSCC tissues using immunohistochemical (IHC) staining

Paraffin sections, 5-μm thick, were sequentially incubated with primary monoclonal SET8 antibodies (Abcam, Cambridge, UK, dilution 1:100) overnight at 4 °C. A secondary polymerised horseradish peroxidase antibody was then added at 37 °C for 1 h, followed by further incubation with streptavidin-peroxidase. Immunohistochemically stained slides were evaluated simultaneously by two experienced pathologists with no knowledge of the clinicopathological information and outcome data. The formula H-score=(i + 1) π was used for semi-quantified assessment, and i was set as the staining intensity (negative, weak, moderate, and strong were recorded as 0, 1, 2, and 3, respectively). π represents the weighted intensity of staining, which varied between 0 and 100%. These two values were multiplied to produce the H-score. The high expression group was characterised by scores greater than 100%, and the low expression group by scores of 100% or less.

Evaluation of SET8 protein expression differences in LSCC cells and normal tissues using western blotting

LSCC cell lines (AMC-HN-8 and TU177) and five cases of normal tissue protein extracts were lysed using a radioimmunoprecipitation assay lysis buffer (Elabscience Biotechnology Co., Ltd., Wuhan, China) and subjected to ultrasonic shaking. Each sample was adjusted for equal amounts and masses and fractionated using 10% SDS-polyacrylamide gel electrophoresis. The transferred membranes were blocked with 5% milk for 1 h and probed with anti-SET8 antibodies (Abcam, Cambridge, UK, dilution 1:1,000). The bands were visualised using ECL (Sangon Biotech Co., Ltd., Shanghai, China), and an anti-β-actin antibody (Abcam, Cambridge, UK) was used as a control.

Cell culture and gene transfection

Human LSCC cell lines, TU177 and AMC-HN-8, were purchased from BNBIO (Beijing, China). TU177 cells were cultured in a RPMI-1,640 medium (GIBCO, NY, USA), whereas AMC-HN-8 cells were grown in Dulbecco’s Modified Eagle’s medium (DMEM; Invitrogen, CA, USA). Both were supplemented with 10% foetal bovine serum (FBS; Invitrogen, CA, USA). Knock down of SET8 was accomplished by small interference RNA (si-RNA). Based on our previous research, we chose to use SET8-siRNA (GeneCopoeia, Rockville, MD; the sequence was GAAUGAAGAUUGACCUCAUCG) which dramatically reduced the protein expression levels of SET8 [10]. Psi-H1-SET8siRNA and psi-H1 plasmids were transfected into human LSCC cell lines using Lipofectamine 2,000 (Thermo Fisher, Shanghai, China) according to the instructions. Cells transfected with the Psi-H1-SET8siRNA were designated as the SET8-siRNA group, negative control siRNA (unspecific RNA interference, scrambled sequence) was used as the control, and untransfected LSCC cells were used as the blank control.

Extraction of total RNA and qRT-PCR

Total RNA was extracted from LSCC cells and 20 cases of corresponding adjacent normal tissues according to manufacturer instructions and reversed transcribed to cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Vaud, Switzerland). Synthetic cDNA was used as a template and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference for qRT-PCR amplification. SET8 primers (Shanghai Sangon Biotech Co., Ltd., Shanghai, China) sequences were listed as follows: forward: 5′- CGCAAACTTACGGATTTCT -3′; reverse: 5′- CGATGAGGTCAATCTTCATT - 3′. qRT-PCR was performed as follows: 95 °C for 10 min; 40 cycles at 95 °C for 15 s, 59 °C for 30 s, and 72 °C for 30 s. The relative expression of SET8 was quantified using 2^−△△Ct. The experiments were assayed in triplicate.

In vitro functional assay

qRT-PCR and western blotting assays were performed to evaluate the mRNA and protein expression levels of EMT markers

qRT-PCR and western blotting assays were used to assess the mRNA and protein expression levels of E-cadherin, N-cadherin, and vimentin in AMC-HN-8 and TU177 cells with SET8 knock down. The primer sequences were listed as follows: E-cadherin: forward: 5′-CGAGAGCTACACGTTCACGG-3′; reverse: 5′- GGCCTTTTGACTGTAATCACACC – 3′, annealing at 59 °C; N-cadherin: forward: 5′-CAACTTGCCAGAAAACTCCAGG-3′; reverse: 5′-ATGAAACCGGGCTATCTGCTC – 3′, annealing at 59 °C; N-cadherin: forward: 5′-TCCACACGCACCTACAGTCT-3′; reverse: 5′-CCGAGGACCGGGTCACATA – 3′, annealing at 57 °C. Relative expression levels were calculated using the 2^−ΔΔCt method. The remaining experimental steps were performed as described above (2.3 and 2.5).

Statistical analysis

Data were analyzed via SPSS 22.0 software and GraphPad Prism 7.0. The Kaplan-Meier method was employed to calculate survival curves, which were compared using the log-rank test. Multivariate survival analysis was performed using a Cox regression model. Student’s t-test and the chi-square test were used for comparisons of different groups. All statistical tests were 2-sided, and p<0.05 was taken as a statistically significant.

SET8 expression was upregulated in LSCC tissues and cell lines, and a higher SET8 protein expression predicted poor prognosis in patients with LSCC

To evaluate SET8 expression in LSCC, IHC, western blotting, and qRT-PCR were performed in LSCC tissues, matched adjacent normal tissues, and cell lines. SET8-positive staining was mainly located in the nucleus with a weaker co-expression in the cytomembrane and cytoplasm. As shown in Figure 1A and B, SET8 proteins were expressed in LSCC tissues and showed absent or very low expression in matched adjacent normal tissues. The results of further correlation analysis revealed that upregulated SET8 expression was correlated with TNM stages in LSCC tissues (p=0.021), with a tendency toward increased SET8 expression at higher tumour stages (Table 1). SET8 expression was not correlated with age (p=0.953), smoking (p=0.133), pathological differentiation (p=0.352), and lymph node metastasis (p=0.055). Western blotting (Figure 1C) analysis confirmed elevated SET8 protein expression in LSCC cell lines and low SET8 protein expression in normal tissues. Consistent with IHC and western blotting results, qRT-PCR analysis showed elevated SET8 level expression in LSCC cells (Figure 1D). The “Pool” was defined as the mean expression level of SET8mRNA in 20 adjacent normal tissues. These results indicate that abnormally high SET8 expression may be vital to tumour progression.

Figure 1:

SET8 protein expression in LSCC. (A) SET8 protein in LSCC using IHC (SP Left × 200; Right × 400). a: High expression in LSCC tissues; b: Low expression in adjacent normal tissues. (B) SET8 expression analysis in LSCC tissues and matched adjacent normal tissues (p<0.01; n=72). (C) The protein expression levels of SET8 were elevated in LSCC cells compared with normal tissue samples. (D) qRT-PCR analysis showing that the expression level of SET8 was significantly upregulated in LSCC cells compared with the “Pool” (p<0.01). (E) Kaplan-Meier curves for overall survival stratified by high and low expression of SET8 in patients with LSCC. Log-rank analysis shows that patients with over-expression of SET8 had significantly poorer survival than those with low expression (p=0.019).

A total of 72 patients were enrolled for survival analysis based on their SET8 expression status. All patients were followed up every 6 months for longer than 60 months; five (6.9%) were lost to follow-up and 67 patients were enrolled in the survival analysis. Survival were analyzed with the Kaplan-Meier method and the log-rank test. Univariate analysis revealed that SET8 expression and pathological differentiation were associated with overall survival in patients with LSCC (Table 2). As shown in Figure 1E, patients with elevated SET8 expression had a significantly shorter overall survival time than those with low expression in the log-rank test analysis. The Cox proportional hazards model revealed that SET8 expression was an independent prognostic factor for survival in patients with LSCC (relative risk=3.713; 95% confidence interval [CI]=1.099–12.669; p=0.035). TNM stage was also identified as a powerful independent predictor for LSCC clinical outcomes (relative risk=0.372; 95% CI=0.161–0.858; p=0.020). These results confirmed that high protein expression of SET8 was an unfavourable prognostic factor for LSCC outcomes (Table 3).

Downregulation of SET8 suppressed LSCC cell proliferation in vitro

Psi-H1-SET8siRNA knockdown was verified using qRT-PCR and western blotting assays. qRT-PCR and western blotting results revealed that SET8 expression was markedly lower in Psi-H1-SET8siRNA transfected cells (Figure 2A, D). CCK-8 and clone formation assays indicated that SET8 knockdown markedly suppressed the proliferation capabilities of LSCC cell lines compared to those of the blank control cells and control-siRNA cell groups (Figure 2E, H).

Figure 2:

Downregulation of SET8 expression suppresses proliferation of LSCC cells in vitro. (A–B) SET8 mRNA expression is markedly lower in SET8-siRNA transfected cells than in the blank control and control-siRNA groups. (C–D) Western blotting showing SET8 protein expression is markedly lower in SET8-siRNA transfected cells than in the blank control and control-siRNA groups. (E–H) CCK-8 and clone formation assays showing that down-regulation of SET8 expression inhibits LSCC cell proliferation ability. *p<0.05, **p<0.01.

Downregulation of SET8 inhibited migration and invasion of LSCC cells in vitro

Wound-healing assays were used to assess migration abilities, and their results showed that the migration ratio was significantly impeded by SET8-siRNA in both SET8-siRNA transfected cell lines compared with that in the blank control and control-siRNA groups (Figure 3A, D). The in vitro invasion assay revealed that SET8 knockdown significantly suppressed LSCC cell invasiveness (Figure 3E and F). Overall, SET8 knockdown significantly suppressed the malignant biological features of LSCC cells.

Figure 3:

Downregulation of SET8 inhibited migration and invasion of LSCC cells in vitro. (A) Wound-healing assay showing that the downregulation of SET8 expression restrains the migration ability of TU177; (B) Quantification of results from A. (C) Wound-healing assay showing that SET8 knockdown inhibits migration ability of AMC-HN-8; (D) Quantification of results from C. (E) Transwell assay demonstrating that downregulation of SET8 expression inhibits invasion ability of TU177; (F) Transwell assay showing that downregulation of SET8 expression inhibits invasion ability of AMC-HN-8; *p<0.05, **p<0.01.

SET8 knockdown suppressed the EMT process

To explore the mechanism of SET8 in LSCC, we assessed whether SET8 knockdown affected EMT. SET8 knockdown upregulated the mRNA and protein expression level of E-cadherin and downregulated N-cadherin and vimentin in AMC-HN-8 and TU177, as detected using qRT-PCR and western blotting methods (Figure 4A, D, p<0.05). These findings demonstrated that higher SET8 exerts tumour-promoting effects via regulating EMT in LSCC.

Figure 4:

SET8 knockdown suppresses EMT progress in LSCC cells. (A–B) Relative mRNA and protein expression levels of E-cadherin, N-cadherin, and vimentin in AMC-HN-8 cell transfected with control-siRNA or SET8-siRNA vectors. (C–D) Relative mRNA and protein expression levels of E-cadherin, N-cadherin, and vimentin in TU177 cell transfected with control-siRNA or SET8-siRNA vectors. Data are expressed as the mean ± SD; *p<0.05, **p<0.01.