Magnolia officinalis and neuronal mitochondrial dysfunction: a potential therapeutic approach for aging or chemotherapy-induced peripheral neuropathy
-
Simge Unay
,
Metin Caliskan
,
Gülsen Bayrak
,
Erkan Tuncay
and
Belma Turan
Abstract
Objectives
Peripheral neuropathy caused by aging and chemotherapy significantly reduces quality of life. Magnolia officinalis (MAGO), a traditional Chinese medicinal plant, is renowned for its anti-inflammatory, antioxidant, and anticancer properties. However, its effects on aging- and chemotherapy-induced peripheral neuropathy remain poorly understood. Therefore, this study aimed to investigate the impact of MAGO on peripheral neuropathy induced by aging or chemotherapy at the cellular level.
Methods
PC12 cell lines were used to establish models of D-galactose (D-gal)-induced aging and cisplatin-induced peripheral neuropathy. Cells in these models were treated with MAGO at concentrations of 5 µM or 10 µM. The effects of MAGO were evaluated by assessing cell viability, immunocytochemistry, RT-PCR, and mitochondrial function through measurement of mitochondrial membrane potential.
Results
MAGO treatment significantly improved cell viability in both D-gal-induced aging (5 µM: 82.2 ± 1.3 %; 10 µM: 78.9 ± 1.0 %) and cisplatin-induced peripheral neuropathy (CIPN5 µM: 74.7 ± 0.3 %; 10 µM: 70.3 ± 0.2 %) model cells. Treatment with MAGO significantly alleviated cellular viability in D-gal-induced aging (5 µM; 82.2 ± 1.3 or 10 µM; 78.9 ± 1.0) or cisplatin-induced peripheral neuropathy (5 µM; 74.7 ± 0.3 or 10 µM; 70.3 ± 0.2) model cells. Treatment with MAGO (5 µM) significantly prevented the upregulation of the apoptosis marker caspase-3 (Cas-3) and mitochondrial uncoupling protein 3 (UCP3), as determined by immunostaining and subsequent quantification. The analysis showed that the elevated levels of these two proteins in the model cells were effectively reduced following MAGO treatment. Additionally, the expression of a mitofusin 1 (MFN1), a key gene involved in mitochondrial function, was also restored in the treated groups. This recovery was consistent with the observed improvement in mitochondrial membrane potential, suggesting a protective role of MAGO in maintaining mitochondrial integrity.
Conclusions
Overall, our data suggest that MAGO has potential in reducing aging-related cellular damage and chemotherapy-induced neuropathy by modulating apoptosis and mitochondrial dysfunction.
Introduction
The rising proportion of elderly individuals across all societies has made the development of new approaches to living conditions that promote healthy aging a significant societal concern. Physiological aging is a very complex process, accompanied by a degenerative impairment in many of the major functions in individuals [1]. Cellular aging is a condition in which cells lose their ability to divide but remain metabolically active. These cells change in different gene expressions, secrete many more pro-inflammatory molecules, and thus impair tissue function [2]. On the other hand, the rising prevalence and growing heterogeneity of cancer disease are driving the urgent need for the development and application of novel therapeutic approaches. In a general aspect, peripheral neuropathy can develop not only as a consequence of aging, but also as a side effect of cancer treatment drugs [2], 3]. Although the primary target of chemotherapy treatments is cancer cells, some of these medications have serious unwanted effects on various types of healthy cells, such as neurons, and have the potential to reduce their proliferation capacity, while there is a close relationship between aging and neuronal vulnerability [4]. The lack of an adequate blood-nerve barrier in the peripheral nervous system makes the sensory neurons and axons more vulnerable to the damage caused by chemotherapeutic agents. A medical condition known as chemotherapy-induced peripheral neuropathy (CIPN) is often the result of repeated exposure to neurotoxic chemotherapy medications [5].
Mitochondria are known as the central organelle in the regulation of energy and metabolic homeostasis in cells, and can explain how mitochondrial functional abnormalities contribute to non-physiological conditions associated with cellular dysfunctions. Since mitochondrial dysfunction includes a range of possible deficiencies given the number of functions in cells by influencing energy production, apoptosis, and overall cell homeostasis, mitochondrial dysfunction has important roles in the development of neuropathy under various pathological stimuli, including physiological aging [6], 7].
There are several review articles to document the importance and roles of natural compounds and products in the elderly’s healthy life with a perspective of their anti-aging actions [8], 9]. There are also studies to demonstrate the role of nutritional supplements for the treatment of peripheral neuropathy and neuropathic pain [10], [11], [12]. Magnolia officinalis (MAGO) is a plant used in traditional Chinese medicine. Magnolol and honokiol are the primary polyphenolic neolignans found in MAGO extract and are a potential resource for natural antioxidants to treat a variety of disorders [13]. The authors demonstrated that MAGO has a comparable antioxidant ability to scavenge radicals and protect DNA [14]. Furthermore, in experimental studies, under both in vivo and in vitro conditions by using different disease models, MAGO provided a significant antioxidant effect in mitochondrial lipid peroxidation of heart tissue [15], protected the myocardium against ischaemic injury, and suppressed ventricular arrhythmia during ischemia and reperfusion [16], prevented depolarization in mitochondria membrane potential and high-level reactive oxygen species (ROS) production and morphological alterations parallel to the function and biochemical attenuations in physiologically aging animals [17]. In addition, MAGO treatment provided significant prevention of doxorubicin-associated cardiac dysfunction in adult rats by presenting well-controlled redox regulation through improvements in activities of glutathione peroxidase and glutathione reductase, and oxygen radical-absorbing capacity of the heart tissues [18], 19]. The cellular level benefits of MAGO in cardiac cells seem to be associated with, at most, its suppression action of aging-related ROS production and regulation of depolarized mitochondrial potential, as well as decreasing the ER-stress and apoptosis marker genes [20]. In addition, it has been shown that MAGO could promote the expression of AMP-activated protein kinase (AMPK), which has beneficial effects on the activation of lipolysis and inhibition of lipogenesis [21]. Further studies also demonstrated that MAGO could stimulate the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway in hepatocytes and protect against oxidative stress. This natural agent also has various benefits through its antidepressant-like synergism to treat a wide range of neurological diseases in animals [22].
A very recent study pointed out the importance of the new action characteristics of MAGO treatment of colorectal cancer. They demonstrated that this natural agent has anti-cancer effects, which are characterized by its multi-component, multi-target, and multi-pathway actions, including inhibition of the over-activation of NF-κBp65/JAK and Bcl-2/Cas-3 signaling pathways, overproduction of ROS, and recovery in mitochondrial function [23]. Therefore, since the mitochondrial dysfunction seems to be a common marker of either aging or chemotherapy-induced peripheral neuropathy, we aimed to examine the possible beneficial effects of MAGO in cell level by using a D-gal-induced aging cell model and a cisplatin-induced chemotherapy-treated cell model.
Materials and methods
Materials
Muse MitoPotential Assay Kit (MMP; MCH100110, EMD Millipore, Billerica, MA, USA) was purchased from Luminex. 3-(4,5-Dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT; M5655), RPMI-1640 (R8758), fetal bovine serum (FBS; F2442), donor horse serum (DHS; H1138), penicillin-streptomycin (P/S; P4333), L-glutamine (G7513), dimethyl sulfoxide (DMSO; D4540), trypsin/EDTA solution (T4049), phosphate buffered saline (PBS; P4474) and D-galactose (D-gal) were purchased from Sigma-Aldrich, Taufkirchen, Germany. PC12 cell line (CRL-1721, Manassas, VA, USA) was purchased from ATCC. Cisplatin (13119, Michigan, USA) was purchased from Cayman. cDNA Synthesis Kit (NP041011620, Turkey), 2X SYBR Green Real-Time PCR Master Mix (NP041010210, Turkey) and Total RNA Extraction Kit (NP041012320, Turkey) were purchased from Nepenthe. IgG anti-rabbit secondary antibody (65–6,140) and Horseradish peroxidase (HRP, 43–4,323) were purchased from Thermo Scientific. Chromogen diaminobenzidine (DAB, ab64238) was purchased from Abcam. All experiments were conducted at the Research Laboratories of the Faculty of Medicine, Usak University.
Cell culture
PC12 cell line (CRL-1721) was cultivated in RPMI-1640 liquid medium supplemented with 10 % DHS, 5 % FBS, 1 % P/S, and 1 % L-glutamine. Cells were cultured in 75 cm2 flasks (CLS3275, Sigma-Aldrich, Taufkirchen, Germany) as a suspension in a humidified incubator (NU5700, Nuaire, Plymouth, USA) in an atmosphere of 5 % CO2 at 37 °C. The media were changed every 2–3 days, and cells were passaged when they reached 80–90 % confluence [24].
PC12 cells were treated with 16 µM cisplatin for the CIPN model for 24 h in 5 % CO2 at 37 °C [24] or 50 mg/mL D-gal for the aging model for 48 h in 5 % CO2 at 37 °C. We bought MAGO commercially. It does not include sugar, soy, dairy, yeast, gluten, or other additives, and includes 2 % honokiol. Following the cells were treated with cisplatin or D-gal, they were incubated with 5 and 10 µM MAGO for 24 h in 5 % CO2 at 37 °C [20]. The substance is a pure powder bulk supplement standardized to contain ≥2 % honokiol and does not include sugar, soy, dairy, yeast, gluten, or other additives [17], 19].
Cell viability analysis
MTT analysis was performed to determine the proliferation capacity of cultured PC12 cells treated with cisplatin, D-gal, and MAGO. MTT reagent at a final concentration of 0.5 mg/mL was added to each well and incubated at 37 °C for 2 h in the dark. After incubation, 300 µL DMSO was used to extract formazan crystals. The absorbance of the formazan solution in DMSO was measured by using a microplate reader (Multiskan Sky Microplate Spectrophotometer, Thermo Fisher Scientific) at 570 nm [24].
Immunocytochemistry
The experimental groups were centrifuged at 56xg for 5 min. After removing the excess supernatant, the cells were resuspended in 50 μL of DPBS. After fixation, the slides were washed three times for 5 min each with PBS and incubated for 10 min in 3 % hydrogen peroxide to block endogenous peroxidase activity. After incubation, the slides were washed with PBS, and normal goat serum was applied to the cells and incubated at room temperature for 8 min. Following incubation, the excess goat serum was removed, and 1:100 diluted Cas-3 or mitochondrial uncoupling protein 3 (UCP3) primary antibodies were applied to the cells and incubated overnight at 4 °C in a humidified chamber. After this incubation, the slides were washed with PBS, and a 1:200 dilution of anti-rabbit IgG secondary antibody was applied and incubated at room temperature for 30 min. The slides were then washed with PBS, and 1:200 diluted HRP was applied to the cells and incubated at room temperature for 10 min in the dark. After incubation, the slides were washed with PBS and treated with DAB. After washing with distilled water, the slides were mounted with Entellan and examined under a light microscope with a camera attachment, and images were captured. For the semi-quantitative evaluation of immunostaining, 10 different areas were scored at 1,000× magnification: (+) no staining, (++) light intensity staining, (+++) moderate intensity staining, (++++) high-intensity staining.
RT-PCR
According to the manufacturer’s instructions, the total RNA Extraction Kit was used to extract total RNA from PC12 cells. A spectrophotometer assessed the quality and quantity of total RNA. The cDNA Synthesis Kit was used to transcribe into cDNA. 2X SYBR Green Real-Time PCR kit was used for mRNA expression with mitofusin 1 (MFN1), mitofusin 2 (MFN2), and mitochondrial fission 1 (FIS1) primers (Table 1). The GAPDH gene was used for housekeeping and analyzed by the relative gene expression 2ˆ−ΔΔCT (2−ΔΔCT) method.
Primers.
| FIS1 | Forward: CTGTTACAGACTGAGCCCCA |
| Reverse: TGAGGCCTGTCACCTTTCTT | |
| MFN1 | Forward: CCTTGTACATCGATTCCTGGGTTC |
| Reverse: CCTGGGCTGCATTATCTGGTG | |
| MFN2 | Forward: AGTCGGTTGGAAGTCACTGT |
| Reverse: TGTACTCGGGCTGAAAGGAG | |
| GAPDH (housekeeping) | Forward: GCTCTCTGCTCCTCCCTGTTCTA |
| Reverse: TGGTAACCAGGCGTCCGATA |
MitoPotential assay
The Muse MitoPotential Assay kit was used to measure mitochondrial membrane potential. PC12 cells were treated with cisplatin, D-gal, and MAGO. Cells were collected with trypsin/EDTA solution. The kit set the cell concentration to 3 × 105 cells/mL in 100 μL of 1X Assay Buffer BA. The cells were then incubated for 20 min at 37 °C in 5 % CO2 after applying 95 μL of Muse working solution. Mitopotential 7-AAD was added and blended in 5 μL after incubation. Cells were examined with the Muse Cell Analyzer [24].
Statistical analysis
The behavioral data were analyzed using one-way analysis of variance (ANOVA) to test whether there was any difference between at least two groups. A significant difference between at least two groups was detected using real data and the statistical software SPSS (IBM SPSS Statistics, USA). The Tukey test was applied as a post hoc test, and a statistical evaluation was made. The data are expressed as mean ± standard deviation (SD), and the probability levels are assigned as *p<0.05, **p<0.01, ***p<0.001, and ***p<0.0001. The Kruskal-Wallis nonparametric test was employed to examine the histopathological scores, with findings provided as median (25th–75th percentile).
Results
MAGO treatment alleviates cell viability in D-gal- or cisplatin-treated cells
The aging-cell model is obtained by using D-gal incubation as described previously [6], 7]. In those studies, although we used elderly rat cardiomyocytes to validate our data, we repeated the examinations by using this type of modelling, particularly in mitochondrial function investigations. This type of modeling could mimic perfectly what is obtained in elderly heart cardiomyocytes.
The model cells obtained either D-gal- (63.8 ± 1.4) or Cisplatin-treatment (63.7 ± 0.7) induced significant decreases in the cell viability compared to the untreated PC12 cells (kept as 100 % cell viability) (Figure 1A and B, respectively). There is about 40 % decrease in the cell viability of these model group cells compared to the control group. The MAGO treatment of the D-gal model cells with either 5 µM (82.2 ± 1.3) or 10 µM (78.9 ± 1.0) for 24 h incubation provided a significant and similar level of recovery in the cell viability compared to the D-gal group while 1 µM and 2.5 µM MAGO had no significant effects (Supplementary Materials 1). The treatment of cisplatin group cells with either 5 µM MAGO (74.7 ± 0.3) or 10 µM MAGO (70.3 ± 0.2) for 24 h incubation also provided a significant and similar level of recovery in the cell viability compared to the cisplatin group.
Cell viability of PC12 cells following D-gal or cisplatin-induced cell models. (A) Cell viability analysis of MAGO treatment (with either 5 µM or 10 µM for 24 h) in PC12 cells following the D-gal-induced aging model. (B) Cell viability analysis of the MAGO-treated PC12 cells in the cisplatin-induced peripheral neuropathy model. Untreated cells are kept as the control group with 100 % cell viability. Data are presented as mean ± SD. The significance levels between groups: 5 µM MAGO treated group **p<0.01 vs. 10 µM MAGO treated group, ****p<0.0001 vs. control group (n=3 independent experiments).
The MAGO treatment of the modelled cells recovered the altered levels of both Cas-3 and UCP3
To determine the levels of either Cas-3 or UCP3 in PC12 cells, we used immunostaining analysis, and then the intensities of loadings were quantified, and comparisons were performed between experimental groups of cells and the untreated control cells. The positive staining of either Cas-3 or UCP3 in both experimental groups of cells (Cisplatin group) was very strong (about 2-fold) compared to the untreated cells (Figure 2, left and right, respectively).
The immunostaining analysis of Cas-3 and UCP3 in the cisplatin-induced peripheral neuropathy modelled PC12 cells compared to the control group PC12 cells. The immunostaining levels of Cas-3 (left column: A–C) and UCP3 (right column: D–F). The control group (A, D), cisplatin group (B, E), cisplatin+5 µM MAGO group (C, F). Black arrowheads indicate non-immunostained cells, white arrowheads indicate weakly stained cells. Magnification 1,000X. The bar graphs are represented as mean ± SD. The significance levels between groups: ****p<0.0001 vs. Control group, *p<0.05 vs. Cisplatin group (n=3 independent experiments/groups/measurements).
Treatment of these modelled cells with 5 µM MAGO for 24 h (in groups of cisplatin+5 µM MAGO and D-gal+5 µM MAGO) significantly recovered the level of Cas-3 staining. The recovery of UCP3 staining following the MAGO treatment was significant in the D-gal+5 µM MAGO group (Figure 3), while its recovery in the cisplatin+5 µM MAGO group was slight, and the difference between the treated and untreated cisplatin group was not statistically significant (Figure 3).
The immunostaining analysis of Cas-3 and UCP3 in the D-gal aging modelled PC12 cells compared to the control group PC12 cells. The immunostaining levels of Cas-3 (left column: A-C) and UCP3 (right column: D-F). The control group (A, D), D-gal group (B, E), and D-gal+5 µM MAGO group (C, F). Black arrowheads indicate non-immunostained cells, white arrowheads indicate weakly stained cells. Magnification 1,000×. The bar graphs are represented as mean ± SD. The significance levels between groups; ****p<0.0001 vs. control group, *p<0.05 vs. cisplatin group (n=3 independent experiments/groups/measurements).
MAGO treatment attenuates the expression levels of fusion and fission factors impaired by aging or CIPN
The mRNA level of MFN1 was significantly increased in the CIPN group, while its level was significantly decreased in the D-gal group compared to their controls (Figure 4A and D, respectively). The MAGO treatment (with 5 µM) of these cells for 24 h provided significant recoveries in both experimental groups of cells. However, there were no significant changes in the expression levels of either MFN2 or FIS1 in both experimental groups of cells, as well as no significant effects with MAGO treatment (Figure 4B–F, respectively).
The attenuation of MAGO treatment in the expression levels of fusion and fission parameters was impaired by aging or cisplatin-induced peripheral neuropathy. The mRNA levels of fusion proteins MFN1 and MFN2, and the fission protein FIS1, in modelled PC12 cells treated or untreated with MAGO, compared to the control cells. CIPN model groups (A–B–C) and D-gal induced aging model groups (D–E–F). The bar graphs are represented as mean ± SD. The significance levels between groups: ****p<0.0001 vs. control group, ***p<0.001 vs. cisplatin group (n=3 independent experiments/groups/measurements).
MAGO treatment ameliorates depolarization of mitochondrial membrane potential in D-gal induced aging modelled or CIPN modelled cells
To determine the changes in the mitochondrial membrane potential in the modelled groups of cells, we used the MitoPotential Assay kit and analyzed the changes in the MitoPotential signals among these groups. Our analysis has demonstrated that the intensity of the signals related to the depolarization level in the mitochondrial membrane potential in either D-gal modelled or cisplatin modelled cells was significantly higher than the control group, demonstrating a significant depolarization in the mitochondrial membrane potential (Figure 5A). In the CIPN model group, like in the D-gal group, a treatment of the modelled cells with 5 µM MAGO provided a significant recovery in the mitochondrial membrane potential depolarization (Figure 5B and C).
The determination of mitochondrial membrane potential by using the Mitopotential assay. The representative original signal traces of the cells from control, D-gal treated, 5 µM MAGO treated D-gal, cisplatin treated, and 5 µM MAGO treated cisplatin group of cells (A). Graphical representation of the D-gal-induced aging model groups (B) and cisplatin-induced peripheral neuropathy model groups (C). The bar graphs are represented as mean ± SD. The significance levels between groups: ****p<0.0001 vs. control group, or MAGO-treated groups vs. D-gal or cisplatin group (n=3 independent experiments/groups/measurements).
Discussion
MAGO is a natural polyphenolic compound with broad therapeutic potential, primarily mediated through its antioxidant activity [13]. It effectively scavenges reactive species, protects DNA integrity, and preserves mitochondrial function [14], 15], 17]. Experimental evidence supports its neuroprotective effects, including antidepressant-like activity and therapeutic relevance in conditions such as anxiety, pain, cerebrovascular injury, epilepsy, and Alzheimer’s disease [22], 25]. In cardiomyocytes, MAGO reduces age-related ROS production, stabilizes mitochondrial membrane potential, and suppresses markers of endoplasmic reticulum (ER) stress and apoptosis, while promoting AMPK expression to regulate lipid metabolism [20], 21]. Additionally, in hepatocytes, MAGO activates the Nrf2 pathway, enhancing cellular defense against oxidative stress [26]. Recent studies also highlight its anticancer properties, particularly in colorectal cancer, through multi-target mechanisms. These include inhibition of the NF-κB p65/JAK and Bcl-2/Cas-3 signaling pathways, as well as restoration of mitochondrial function [23]. Collectively, these findings position MAGO as a multifunctional natural compound with significant therapeutic potential in neurological, cardiovascular, metabolic, and oncological diseases [22], 25].
In the present study, we hypothesized that MAGO may exert beneficial effects in cell models mimicking either aging or chemotherapy-induced peripheral neuropathy. Our data demonstrated that MAGO treatment significantly improved cell viability in both D-gal-induced aging and cisplatin-induced peripheral neuropathy models. Treatment with MAGO significantly prevented the upregulation of Cas-3, a marker of apoptosis, and UCP3, a mitochondrial marker, in these models. Quantification of these proteins revealed that their elevated levels in the modelled cells were effectively reduced following MAGO treatment. Furthermore, we found that the mRNA expression of MFN1, a marker of mitochondrial function, was also restored with MAGO treatment in both models. This finding was accompanied by a significant reduction in mitochondrial membrane depolarization. These findings suggest that this natural compound exhibits multifunctional properties through various mechanisms, including its pleiotropic effects. These results are consistent with previous reports on diverse biological actions of MAGO, including its protective role against chemotherapy-induced side effects in mammalian systems [22]. Indeed, it has been well-documented that while chemotherapeutic agents such as doxorubicin, paclitaxel, cisplatin, and docetaxel are effective against cancer cells, they also exert neurotoxic effects on neuronal cells [27]. Cisplatin, in particular, binds to DNA and inhibits replication, leading to increased cytokine release and activation of apoptotic pathways. In neuronal cells, cisplatin contributes to elevated ROS levels and impaired mitochondrial function [28]. The severity of its neurotoxic, myotoxic, and nephrotoxic effects depends on the dosage and duration of administration [24].
Studies have also shown that chemotherapeutic agents can cause mitochondrial dysfunction and disrupt mitochondrial dynamics [29], 30]. In peripheral neurons, these agents are thought to impair mitochondrial fusion by reducing the expression or function of MFN1 and MFN2. However, a definitive consensus has not yet been reached in the literature. This discrepancy is believed to stem from variations in drug concentration, exposure duration, and the type of cells used in different studies [31].
Mitochondrial dysfunction, primarily through increased oxidative stress, is widely recognized as a key component in the pathogenesis of peripheral neuropathy. Cisplatin, a platinum-based chemotherapeutic agent, binds to mitochondrial DNA (mtDNA) in neuronal cells and forms adducts that interfere with mtDNA structure. Due to the absence of a DNA repair system in mitochondria, this damage cannot be effectively reversed. These mtDNA adducts disrupt transcription and replication, ultimately impairing the mitochondrial respiratory chain [28], 32]. The resulting mitochondrial dysfunction leads to reduced cellular metabolism. Cisplatin also induces lipid peroxidation, DNA oxidation, and a significant increase in superoxide anion generation, all of which contribute to oxidative stress and mitochondrial dysfunction in neuron-like cells. In our previous study, we demonstrated that cisplatin significantly increased mitochondrial membrane depolarization in both differentiated and undifferentiated PC12 cells compared to the control group [24]. Similarly, chemotherapy-induced peripheral neuropathy shares mechanistic similarities with physiological aging, an irreversible biological process characterized by the gradual decline of physical and neurological functions. This deterioration contributes to the development of age-related diseases in various tissues and organs. While the full mechanism of aging remains unclear, excessive production of ROS is known to accelerate the aging process [1]. During aging, an imbalance between ROS production and antioxidant defense systems leads to elevated oxidative stress and mitochondrial dysfunction [33]. In addition, apoptosis, a form of programmed cell death, is associated with both physiological and pathological conditions. Oxidative damage mediated by free radicals is a well-established trigger for apoptosis, activating various apoptotic pathways [34]. Chemotherapeutic agents are known to induce mitochondrial dysfunction in both cancerous and neuronal cells, often activating Cas-3 through oxidative stress [35], 36]. For example, Khademi et al. (2019) reported a marked increase in Cas-3 expression in dorsal root ganglion (DRG) cells isolated from cisplatin-treated rats [37]. The UCPs, located in the inner mitochondrial membrane, are activated by ROS to protect cells from oxidative damage. UCPs play protective roles against both oxidative stress and mitochondrial dysfunction [38], [39], [40]. Specifically, UCP3 expression increases in conditions of mitochondrial damage, such as peripheral neuropathy [41]. In the present study, we observed elevated levels of UCP3 and Cas-3 in PC12 cells treated with cisplatin. These findings are consistent with previous literature, supporting the involvement of mitochondrial dysfunction and oxidative stress in cisplatin-induced neurotoxicity.
It has been well established in the literature that mitochondrial function is impaired during the aging process [42]. Studies have shown that in D-gal-induced aged mice (24 months), the gene expression of MFN1, MFN2, and mitochondrial dynamin-like GTPase (OPA1) is decreased, while the expression of FIS1 and dynamin-related protein 1 (DRP1) remains unchanged [42]. Other studies, however, report upregulation of FIS1 and DRP1 in naturally aged rats (20–24 months), accompanied by mitochondrial dysfunction and a decline in MFN1 and OPA1 expression. A decrease in MFN2 expression was also observed in these aged rats [43]. In our study, we observed a significant downregulation of MFN1 gene expression in D-gal-induced aging-modeled PC12 cells, whereas FIS1 and MFN2 expression levels remained unchanged. Du et al. (2021) demonstrated that levels of UCPs were significantly elevated in the hippocampus of rats subjected to D-galactose-induced aging, compared to control groups. They suggested that increased ROS production and UCP3 overexpression may contribute to a compensatory reduction in mitochondrial ROS levels in the hippocampus [44]. In a follow-up study, Du et al. (2012) also found significantly higher UCP3 levels in the inner ear tissue of D-galactose-treated aging rats compared to controls [45]. Cell death associated with aging is driven by several molecular mechanisms, including chronic inflammation and oxidative stress. Cas-3, a central regulator of apoptosis and programmed cell death, is widely recognized as a key marker of these processes.
Studies have shown that MAGO possesses antioxidant, antiallergic, and anticancer properties. It has also been reported to activate extracellular signal-regulated kinases (ERK) and modulate the production of various pain-related signaling molecules, such as tumor necrosis factor-alpha (TNF-α) and nitric oxide. In addition, the anticancer effects of MAGO have been demonstrated in lung, colorectal, breast, and melanoma cancers through both in vitro and in vivo studies [46], 47]. However, studies investigating the effects of MAGO on CIPN and aging are currently limited. In the present study, we demonstrated the effects of MAGO on both aging and CIPN using PC12 cells. Our findings indicate that MAGO effectively minimized cell damage in a D-galactose-induced aging model and in a cisplatin-induced peripheral neuropathy model.
Conclusions
In this study, we investigated the therapeutic effects of MAGO on D-gal-induced aging and CIPN in PC12 cells. Our findings suggest that MAGO may serve as a promising natural therapeutic agent for mitigating both aging-related cellular dysfunction and chemotherapy-induced nerve damage. In the D-gal-induced aging model, MAGO was found to attenuate cellular aging by significantly reducing mitochondrial membrane depolarization. Additionally, MAGO showed potential in alleviating cisplatin-induced peripheral neuropathy, likely by minimizing neuropathic pain and nerve cell damage. Further research is needed to fully elucidate MAGO’s mechanisms of action and confirm its therapeutic potential in vivo.
Funding source: Türkiye Bilimsel ve Teknolojik Araştırma Kurumu
Award Identifier / Grant number: 223S224
-
Research ethics: Not applicable.
-
Informed consent: Not applicable.
-
Author contributions: SU: Conceptualization, Data curation, Formal Analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Validation, Visualization, Writing–original draft, Writing–review and editing. MC: Funding acquisition, Investigation, Data curation, Writing–review and editing. GB: Investigation, Data curation, Writing–review and editing. ET: Funding acquisition, Conceptualization. BT: Funding acquisition, Conceptualization, Supervision, Writing–review and editing.
-
Use of Large Language Models, AI and Machine Learning Tools: None declared.
-
Conflict of interest: The authors state no conflict of interest.
-
Research funding: The study was supported by the Scientific and Technological Research Council of Turkey (TUBITAK), No. 223S224.
-
Data availability: Not applicable.
References
1. Hill, M, Třískala, Z, Honců, P, Krejčí, M, Kajzar, J, Bičíková, M, et al.. Aging, hormones and receptors. Physiol Res 2020;69:S255–72. https://doi.org/10.33549/physiolres.934523.Search in Google Scholar PubMed PubMed Central
2. Goss, JR, Stolz, DB, Robinson, AR, Zhang, M, Arbujas, N, Robbins, PD, et al.. Premature aging-related peripheral neuropathy in a mouse model of progeria. Mech Ageing Dev 2011;132:437–42. https://doi.org/10.1016/j.mad.2011.04.010.Search in Google Scholar PubMed PubMed Central
3. Colvin, LA. Chemotherapy-induced peripheral neuropathy: where are we now? Pain 2019:S1–10. https://doi.org/10.1097/j.pain.0000000000001540.Search in Google Scholar PubMed PubMed Central
4. Starobova, H, Vetter, I. Pathophysiology of chemotherapy-induced peripheral neuropathy. Front Mol Neurosci 2017;10. https://doi.org/10.3389/fnmol.2017.00174.Search in Google Scholar PubMed PubMed Central
5. Au, NPB, Fang, Y, Xi, N, Lai, KWC, Ma, CHE. Probing for chemotherapy-induced peripheral neuropathy in live dorsal root ganglion neurons with atomic force microscopy. Nanomedicine 2014;10:1323–33. https://doi.org/10.1016/j.nano.2014.03.002.Search in Google Scholar PubMed
6. Durak, A, Turan, B. Liraglutide provides cardioprotection through the recovery of mitochondrial dysfunction and oxidative stress in aging hearts. J Physiol Biochem 2023;79:297–311. https://doi.org/10.1007/s13105-022-00939-9.Search in Google Scholar PubMed
7. Olgar, Y, Degirmenci, S, Durak, A, Billur, D, Can, B, Mutlu, GK, et al.. Aging related functional and structural changes in the heart and aorta: MitoTEMPO improves aged-cardiovascular performance. Exp Gerontol 2018;110:172–81. https://doi.org/10.1016/j.exger.2018.06.012.Search in Google Scholar PubMed
8. Bjørklund, G, Shanaida, M, Lysiuk, R, Butnariu, M, Peana, M, Sarac, I, et al.. Natural compounds and products from an anti-aging perspective. Molecules 2022;27. https://doi.org/10.3390/molecules27207084.Search in Google Scholar PubMed PubMed Central
9. Liu, J-K. Antiaging agents: safe interventions to slow aging and healthy life span extension. Nat Prod Bioprospect. 2022;12:18. https://doi.org/10.1007/s13659-022-00339-y.Search in Google Scholar PubMed PubMed Central
10. Dewanjee, S, Sohel, M, Hossain, MS, Ansari, F, Islam, MT, Sultana, F, et al.. A comprehensive review on clinically proven natural products in the management of nerve pain, with mechanistic insights. Heliyon 2023;9:e15346. https://doi.org/10.1016/j.heliyon.2023.e15346.Search in Google Scholar PubMed PubMed Central
11. Yang, J, Wei, Y, Zhao, T, Li, X, Zhao, X, Ouyang, X, et al.. Magnolol effectively ameliorates diabetic peripheral neuropathy in mice. Phytomedicine 2022;107. https://doi.org/10.1016/j.phymed.2022.154434.Search in Google Scholar PubMed
12. Dong, L, Zhou, S, Yang, X, Chen, Q, He, Y, Huang, W. Magnolol protects against oxidative stress-mediated neural cell damage by modulating mitochondrial dysfunction and PI3K/Akt signaling. J Mol Neurosci 2013;50:469–81. https://doi.org/10.1007/s12031-013-9964-0.Search in Google Scholar PubMed
13. Poivre, M, Duez, P. Biological activity and toxicity of the Chinese herb Magnolia officinalis Rehder & E. Wilson (Houpo) and its constituents. J Zhejiang Univ Sci B 2017:194–214. https://doi.org/10.1631/jzus.B1600299.Search in Google Scholar PubMed PubMed Central
14. Zhao, C, Liu, ZQ. Comparison of antioxidant abilities of magnolol and honokiol to scavenge radicals and to protect DNA. Biochimie 2011;93:1755–60. https://doi.org/10.1016/j.biochi.2011.06.012.Search in Google Scholar PubMed
15. Yu-Chiang, L, Che-Ming, T, Chieh-Fu, C, Chien-Chih, C, Chuang-Ye, H. Magnolol and honokiol isolated from magnolia officinalis protect rat heart mitochondria against lipid peroxidation. Biochem Pharmacol. 1994;47:549–53. https://doi.org/10.1016/0006-2952(94)90187-2.Search in Google Scholar PubMed
16. Tsai, SK, Huang, SS, Hong, CY. Myocardial protective effect of honokiol: an active component in Magnolia officinalis. Planta Med 1996;62:503–6. https://doi.org/10.1055/s-2006-957957.Search in Google Scholar PubMed
17. Billur, D, Aktay, I, Bayram, P, Bitirim, CV, Turan, B. Morphological and functional analysis of cardiac ameliorations in elderly rats supplemented with a magnolol extract complex. Int J Morphol 2023;41:915–25. https://doi.org/10.4067/s0717-95022023000300915.Search in Google Scholar
18. Ünay, S, Aktay, I, Turan, B. Magnoli̇a bark ekstrakti uygulamasinin yaşli fare kalp fonksi̇yon yetersizliğindeki i̇yi̇leşti̇ri̇ci̇ etki̇leri̇. Kocatepe Tıp Dergisi 2024;25:227–34. https://doi.org/10.18229/kocatepetip.1302307.Search in Google Scholar
19. Aktay, I, Bitirim, CV, Olgar, Y, Durak, A, Tuncay, E, Billur, D, et al.. Cardioprotective role of a magnolol and honokiol complex in the prevention of doxorubicin-mediated cardiotoxicity in adult rats. Mol Cell Biochem 2024;479:337–50. https://doi.org/10.1007/s11010-023-04728-w.Search in Google Scholar PubMed
20. Verda, BC. The regulatory effects of Magnolia officinalis extract on aging-induced mitochondrial dysfunction in cardiomyocytes. J Ank Univ Fac Med 2022;75:22–7. https://doi.org/10.4274/atfm.galenos.2021.98698.Search in Google Scholar
21. Choi, WJ, Kim, MH, Park, N, Chung, JY, Park, SJ, Yang, WM. Effect and mechanism of Magnolia officinalis pharmacopuncture for treating localized fat via network pharmacology and experimental study. Integr Med Res 2023;12. https://doi.org/10.1016/j.imr.2023.100948.Search in Google Scholar PubMed PubMed Central
22. Dai, X, Xie, L, Liu, K, Liang, Y, Cao, Y, Lu, J, et al.. The neuropharmacological effects of magnolol and honokiol: a review of signal pathways and molecular mechanisms. Curr Mol Pharmacol 2022;16:161–77. https://doi.org/10.2174/1874467215666220223141101.Search in Google Scholar PubMed
23. Zhang, H, Tang, J, Cao, H, Wang, C, Shen, C, Liu, J. Effect and mechanism of Magnolia officinalis in colorectal cancer: multi-component-multi-target approach. J Ethnopharmacol 2025;338. https://doi.org/10.1016/j.jep.2024.119007.Search in Google Scholar PubMed
24. Unay, S, Bilgin, MD. Investigation of effects of quercetin and low-level laser therapy in cisplatin-induced in vitro peripheral neuropathy model. Lasers Med Sci 2023;38. https://doi.org/10.1007/s10103-023-03718-0.Search in Google Scholar PubMed
25. Yi, LT, Xu, Q, Li, YC, Yang, L, Kong, LD. Antidepressant-like synergism of extracts from magnolia bark and ginger rhizome alone and in combination in mice. Prog Neuropsychopharmacol Biol Psychiatr 2009;33:616–24. https://doi.org/10.1016/j.pnpbp.2009.03.001.Search in Google Scholar PubMed
26. Rajgopal, A, Missler, SR, Scholten, JD. Magnolia officinalis (Hou Po) bark extract stimulates the Nrf2-pathway in hepatocytes and protects against oxidative stress. J Ethnopharmacol 2016;193:657–62. https://doi.org/10.1016/j.jep.2016.10.016.Search in Google Scholar PubMed
27. Zajaczkowską, R, Kocot-Kępska, M, Leppert, W, Wrzosek, A, Mika, J, Wordliczek, J. Mechanisms of chemotherapy-induced peripheral neuropathy. Int J Mol Sci 2019;20. https://doi.org/10.3390/ijms20061451.Search in Google Scholar PubMed PubMed Central
28. Canta, A, Pozzi, E, Carozzi, VA. Mitochondrial dysfunction in chemotherapy-induced peripheral neuropathy (CIPN). Toxics 2015;3:198–223. https://doi.org/10.3390/toxics3020198.Search in Google Scholar PubMed PubMed Central
29. Bobylev, I, Joshi, AR, Barham, M, Neiss, WF, Lehmann, HC. Depletion of Mitofusin-2 causes mitochondrial damage in cisplatin-induced neuropathy. Mol Neurobiol 2018;55:1227–35. https://doi.org/10.1007/s12035-016-0364-7.Search in Google Scholar PubMed
30. Zhan, L, Li, R, Sun, Y, Dou, M, Yang, W, He, S, et al.. Effect of mito-TEMPO, a mitochondria-targeted antioxidant, in rats with neuropathic pain. Neuroreport 2018;29:1275–81. https://doi.org/10.1097/wnr.0000000000001105.Search in Google Scholar
31. Jannuzzi, AT, Arslan, S, Yilmaz, AM, Sari, G, Beklen, H, Méndez, L, et al.. Higher proteotoxic stress rather than mitochondrial damage is involved in higher neurotoxicity of bortezomib compared to carfilzomib. Redox Biol 2020;32. https://doi.org/10.1016/j.redox.2020.101502.Search in Google Scholar PubMed PubMed Central
32. McQuade, RM, Stojanovska, V, Bornstein, JC, Nurgali, K. PARP inhibition in platinum-based chemotherapy: chemopotentiation and neuroprotection. Pharmacol Res 2018;137:104–13. https://doi.org/10.1016/j.phrs.2018.09.031.Search in Google Scholar PubMed
33. Shadel, GS, Horvath, TL. Mitochondrial ROS signaling in organismal homeostasis. Cell 2015;163:560–9. https://doi.org/10.1016/j.cell.2015.10.001.Search in Google Scholar PubMed PubMed Central
34. Guo, J, Xing, H, Chen, M, Wang, W, Zhang, H, Xu, S. H2S inhalation-induced energy metabolism disturbance is involved in LPS mediated hepatocyte apoptosis through mitochondrial pathway. Sci Total Environ 2019;663:380–6. https://doi.org/10.1016/j.scitotenv.2019.01.360.Search in Google Scholar PubMed
35. Podratz, JL, Knight, AM, Ta, LE, Staff, NP, Gass, JM, Genelin, K, et al.. Cisplatin induced mitochondrial DNA damage in dorsal root ganglion neurons. Neurobiol Dis 2011;41:661–8. https://doi.org/10.1016/j.nbd.2010.11.017.Search in Google Scholar PubMed PubMed Central
36. Gill, JS, Windebank, AJ. Cisplatin-induced apoptosis in rat dorsal root ganglion neurons is associated with attempted entry into the cell cycle. J Clin Investig 1998;101:2842. https://doi.org/10.1172/jci1130.Search in Google Scholar PubMed PubMed Central
37. Khademi, E, Mahabadi, VP, Ahmadvand, H, Akbari, E, Khalatbary, AR. Anti-inflammatory and anti-apoptotic effects of hyperbaric oxygen preconditioning in a rat model of cisplatin-induced peripheral neuropathy. Iran J Basic Med Sci 2020;23:321. https://doi.org/10.22038/IJBMS.2019.40095.9504.Search in Google Scholar PubMed PubMed Central
38. Rousset, S, Alves-Guerra, MC, Mozo, J, Miroux, B, Cassard-Doulcier, AM, Bouillaud, F, et al.. The biology of mitochondrial uncoupling proteins. Diabetes 2004;53(1 Suppl). https://doi.org/10.2337/diabetes.53.2007.s130.Search in Google Scholar PubMed
39. Mailloux, RJ, Harper, ME. Uncoupling proteins and the control of mitochondrial reactive oxygen species production. Free Radic Biol Med 2011;51:1106–15. https://doi.org/10.1016/j.freeradbiomed.2011.06.022.Search in Google Scholar PubMed
40. Mailloux, RJ. Teaching the fundamentals of electron transfer reactions in mitochondria and the production and detection of reactive oxygen species. Redox Biol 2015;4:381–98. https://doi.org/10.1016/j.redox.2015.02.001.Search in Google Scholar PubMed PubMed Central
41. Vincent, AM, Olzmann, JA, Brownlee, M, Sivitz, WI, Russell, JW. Uncoupling proteins prevent glucose-induced neuronal oxidative stress and programmed cell death. Diabetes 2004;53:726–34. https://doi.org/10.2337/diabetes.53.3.726.Search in Google Scholar PubMed
42. Whitehead, N, Gill, JF, Brink, M, Handschin, C. Moderate modulation of cardiac PGC-1α expression partially affects age-associated transcriptional remodeling of the heart. Front Physiol 2018;9:338109. https://doi.org/10.3389/fphys.2018.00242.Search in Google Scholar PubMed PubMed Central
43. No, MH, Heo, JW, Yoo, SZ, Kim, CJ, Park, DH, Kang, JH, et al.. Effects of aging and exercise training on mitochondrial function and apoptosis in the rat heart. Pflugers Arch 2020;472:179–93. https://doi.org/10.1007/s00424-020-02357-6.Search in Google Scholar PubMed
44. Du, J, Cui, J, Yang, J, Wang, P, Zhang, L, Luo, B, et al.. Alterations in cerebral hemodynamics during microgravity: a literature review. Med Sci Monit 2021;27. https://doi.org/10.12659/msm.928108.Search in Google Scholar
45. Du, Z, Yang, Y, Hu, Y, Sun, Y, Zhang, S, Peng, W, et al.. A long-term high-fat diet increases oxidative stress, mitochondrial damage and apoptosis in the inner ear of D-galactose-induced aging rats. Hear Res 2012;287:15–24. https://doi.org/10.1016/j.heares.2012.04.012.Search in Google Scholar PubMed
46. Song, JH, Lee, CJ, An, HJ, Yoo, SM, Kang, HC, Lee, JY, et al.. Magnolin targeting of ERK1/2 inhibits cell proliferation and colony growth by induction of cellular senescence in ovarian cancer cells. Mol Carcinog 2019;58:88–101. https://doi.org/10.1002/mc.22909.Search in Google Scholar PubMed PubMed Central
47. Huang, Y, Zou, X, Zhang, X, Wang, F, Zhu, W, Zhang, G, et al.. Magnolin inhibits prostate cancer cell growth in vitro and in vivo. Biomed Pharmacother 2017;87:714–20. https://doi.org/10.1016/j.biopha.2017.01.010.Search in Google Scholar PubMed
Supplementary Material
This article contains supplementary material (https://doi.org/10.1515/tjb-2025-0290).
© 2025 the author(s), published by De Gruyter, Berlin/Boston
This work is licensed under the Creative Commons Attribution 4.0 International License.
