Home Medicine Isoquercitrin attenuates neuroinflammation in LPS-stimulated BV2 microglia cells via p38MAPK/NF-κB pathway
Article Open Access

Isoquercitrin attenuates neuroinflammation in LPS-stimulated BV2 microglia cells via p38MAPK/NF-κB pathway

  • Shiyi Chang ORCID logo , Yan Chang ORCID logo , Jiajia Wang ORCID logo and Xuelian Huang ORCID logo EMAIL logo
Published/Copyright: August 6, 2024
Download Article (PDF)
Turkish Journal of Biochemistry
From the journal Turkish Journal of Biochemistry Volume 49 Issue 4

Abstract

Objectives

Microglia mediated neuronal inflammation has been reported to be responsible for neurodegenerative disease. Isoquercitrin (IQC), widely found in fruits, vegetables and foods, has high bioavailability and offers many benefits of humans. Although IQC has been shown to possess pleiotropic biological activities, but its anti-inflammatory mechanism in microglia at molecular level remains largely unclear. Therefore, this study aimed to investigate IQC’s inhibition on inflammation within BV2 microglia cells induced by lipopolysaccharide (LPS) and the underlying mechanism.

Methods

The cell viability was tested by using the MTT assay and the NO production was measured by Griess reagent. Inflammatory cytokines expression was determined by RT-qPCR and the expression of iNOS、COX2 and correlation factor of NF-κB and MAPK pathway were determined by RT-qPCR and western blotting.

Results

IQC does not affect the viability of LPS-stimulated microglia. IQC treatment inhibited LPS-triggered NO and PGE2 production, iNOS and COX2 expression and affected the mRNA levels of relative inflammatory cytokines. Moreover, IQC inhibited nuclear factor kappa B(NF-κB) and MAPK pathway activation mediated by LPS, thereby inhibiting the levels of inflammatory cytokines.

Conclusions

IQC exhibited remarkable anti-inflammatory effects and promised therapeutic potential for neural inflammation associated diseases.

Keywords: isoquercitrin; neuroinflammation; BV2; NF-κB and MAPK signaling

Introduction

As the most important immunocyte type within central nervous system (CNS), microglia not only participate in the physiological processes of neurogenesis, but also have a critical part in different pathological processes like neurodegenerative lesions, nerve damage and tumors [1], [2], [3], [4]. Microglia become rapidly activated in response to infection, brain injury or neurodegenerative diseases. The activated microglia release a variety of cytokines, including small molecule messengers (prostaglandins, nitric oxide (NO), reactive oxygen species (ROS)), tumor necrosis factor-alpha (TNF-α), interleukins (IL-1β, IL-6, IL-18) and chemokine ligands (CCL1, CCL5), resulting in neuroinflammation, which induce neuronal death [5]. Therefore, inhibiting the excessive microglial activation, blocking pro-inflammatory cascade signal have ameliorative and even therapeutic effects on CNS disorders [6, 7].

The molecular mechanism of microglia activation is not fully elucidated. The Gram-negative bacterial cell wall endotoxin lipopolysaccharide (LPS) is one of the most effective microglia activators. Changes in extracellular LPS concentration are sensed by the toll-like receptor 4 (TLR4), and the signal is then transmitted into the cell [8]. The cellular transcription factor nuclear factor-kappa B (NF-κB) as well as the mitogen-activated protein kinases (MAPKs) pathway were reported to be involved in LPS-mediated activation of microglia [9], [10], [11]. Activating the p38MAPK and NF-κB signaling pathways initiates the transcription of multiple pro-inflammatory genes ultimately releasing a series of inflammatory mediators including cytotoxic substances ROS, NO and pro-inflammatory factors such as TNF-α and IL-1β [12], [13], [14], [15].

Isoquercitrin (IQC) is a glycoside form of quercetin, also known as quercetin 3-O-glucoside, which is widely found in fruits, vegetables and foods. Therefore, it has higher bioavailability than quercetin and offers many benefits to humans [16]. IQC exerts powerful inhibitory actions on excessive oxidative stress and inflammatory responses [17]. Therefore, IQC has therapeutic effects on a variety of diseases, such as allergies, cardiovascular diseases, loss of neuromuscular atrophy and autism [18], [19], [20], [21], [22]. Despite its pleiotropic biological activity, it is not clear whether IQC can attenuate microglia inflammation and by what mechanism.

In this study, we demonstrated that IQC reduced microglia-mediated inflammation in a dose-dependent manner. Not only that, we also found that IQC inhibited the activity of NF-κB and p38MAPK signaling pathways in the LPS-stimulated microglia. These data provide new insights into the alleviation of CNS inflammation.

Materials and methods

Reagents

IQC, purity greater than 98 %, was provided by Pureone-Biotech (Shanghai, China). LPS purchased at Sigma (St. Louise, Missouri, MO, USA). DMEM, PBS, penicillin-streptomycin (P/S) and fetal bovine serum (FBS) were provided by Gibco (Gaithersburg, Maryland, MD, USA). GAPDH (Cell Signaling Technology (CST) #2118,USA), NF-κB (CST#8242,USA), p-NF-κB (CST #3033,USA), IKKα (CST#11930,USA), p-IKKα (Ser176/180) (CST#2694,USA), p-p38 (CST#4511,USA), p38 (CST#8690,USA), p-ERK (CST#4370,USA), ERK (CST#4695,USA), MEK (CST#4694,USA), p-ERK (CST#2338,USA) antibodies, together with the corresponding secondary antibodies were provided by Cell Signaling Technology (Boston, Massachusetts, MA, USA), iNOS (AF7281) and COX2 (AF1924) antibodies were purchased from Beyotime (Shanghai, China).

Cell culture and treatment

This study kept BV2 cells (Cell Bank, Chinese Academy of Sciences, Shanghai, China) within the humid incubator under 5 % CO2 and 37 °C conditions, followed by culture within the high-glucose DMEM that contained 10 % FBS, and 1 % (P/S). Before experiments, we transferred cells into the 6-well (5×105 cells/well), 24-well (1×104 cells/well), or 96-well (5×103 cells/well) plates to incubate overnight. IQC (20, 40, 80 μg/mL), dissolved in DMSO or DMSO (vehicle control) was utilized to pretreat BV2 cells in each experiment for 24 h prior to the addition of LPS (1 μg/mL, 12 h).

Cell viability assay

MTT assay kit (Beyotime, Shanghai, China) was conducted to test cell viability. After seeding in the 96-well-plate, BV2 cells were incubated with IQC as the indicated concentration. 24 h later, LPS was added to treat cells for another 12 h. Finally, MTT assay was measured according to the instruction manual. Absorbance was determined at 450 nm by the microtiter plate reader (Molecular Devices, Menlo Park, CA).

Determination of nitrite and PGE2 generation

First of all, IQC was used to treat cells for 24 h, followed by stimulation with LPS at 1 μg/mL for 12 h. Thereafter, medium (100 µL) was added into the new 96-well plate, followed by the addition of Griess reagent (100 µL, Beyotime, Shanghai, China) as well as 15 min of incubation under 37 °C. Finally, the optical density (OD) value was measured at 540 nm.

PGE2 measure

BV2 microglia cells were seeded in six‐well plates at a density of 2×105 cells/mL. Cells were treated with IQC for 30 min prior to stimulation with LPS by the next day. 24 h later, the cells were collected and centrifuged, and the PGE2 in the supernatant was measured by a PGE2 ELISA kit (PKGE004B, R&D Biosystem) according to the manufacturer’s protocol.

RNA isolation and RT-qPCR

Total cellular RNA was extracted with TRIzol (Invitrogen, Carlsbad, CA, USA). Reverse transcription (RT) reaction was performed with cDNA Synthesis Kit (Vazyme Biotech, Nanjing, China) following general protocols. Then, RT-PCR was carried out using the Applied Biosystems 7500 RT-PCR system (Applied Biosystems, Foster City, CA, USA). Table 1 shows the primers (GENEWIZ Biotech, Suzhou, China) used in this work.

Table 1:

Primers utilized in the present study.

Primer name Nucleotide sequence (5′−3′)
iNOS-forward ATGTCCGAAGCAAACATCAC
iNOS-reverse TAATGTCCAGGAAGTAGGTG
COX-2-forward GCCAGCAAAGCCTAGAGCAA
COX-2-reverse GCCTTCTGCAGTCCAGGTTC
IL-1β-forward GAAATGCCACCTTTTGACAGTG
IL-1β-reverse TGGATGCTCTCATCAGGACAG
IL-6-forward CTGCAAGAGACTTCCATCCAG
IL-6-reverse AGTGGTATAGACAGGTCTGTTGG
TNF-α-forward CTGAACTTCGGGGTGATCGG
TNF-α-reverse GGCTTGTCACTCGAATTTTGAGA
GAPDH-forward TCAACGGGAAGCTCACTGG
GAPDH-reverse CCCCAGCATCGAAGGTAGA

Protein isolation and western blotting (WB) assay

The treated cells were collected and rinsed by pre-chilled PBS twice, followed by 20 min of on-ice lysis with RIPA lysis buffer (Beyotime) that contained protease inhibitors PMSF (Beyotime), and another 30 min of centrifugation at 12000g and 4 °C. Proteins were loaded on SDS-PAGE, followed by transfer onto nitrocellulose membranes (Millipore, Bedford, MA). After blocking using 5 % nonfat milk under ambient temperature for 1 h, membranes were blotted using antibodies against primary antibodies. Then, membranes were rinsed by TBST for 10 min thrice, and HRP-labeled secondary antibody was utilized to incubate blots under ambient temperature for 1 h. Then, blots were rinsed by TBST for 10 min thrice, followed by visualization of protein bands using the ECL Western Blotting Detection kit (Beyotime, Shanghai, China).

Statistical analysis

GraphPad Prism software version 7 (Graph Pad software Inc., CA, USA) was utilized to analyze results that were presented in a form of mean±SEM. Statistical significance were analyzed by one-way ANOVA. */# p<0.0, **/## p<0.01 indicated statistical significance.

Results

IQC does not affect cell viability on LPS-induced BV2 microglial at optimal concentrations

To estimate whether the IQC treatment had cytotoxicity against activated BV2 cells, MTT assay was used to measure the cell viability. According to previous studies, IQC was usually effective in cellular models at concentrations of 10 μM and above [23]. Therefore, we set four concentration gradients of 0, 20, 40 and 80 μg/mL. BV2 cells were treated with LPS for 24 h, with or without the suplement of IQC and at any concentration, and the results showed no significant change in cell survival (Figure 1). The results implied that IQC was almost non-cytotoxic to LPS-induced BV2 microglia at the experimental concentrations.

Figure 1: IQC does not affect cell viability on LPS-induced BV2 microglial at optimal concentrations. After IQC treatment for 24 h, cells were exposed to 12 h of LPS treatment. MTT assay was conducted to detect cell viability. LPS, lipopolysaccharide. + and – indicate with and without LPS (1 μg/mL) treatment, separately. One-way ANOVA was utilized to determine statistical significance. The results were displayed in a form of mean±SEM from 3 independent experiments. **p<0.01 relative to control group without LPS. ## p<0.01 relative to LPS group.
Figure 1:

IQC does not affect cell viability on LPS-induced BV2 microglial at optimal concentrations. After IQC treatment for 24 h, cells were exposed to 12 h of LPS treatment. MTT assay was conducted to detect cell viability. LPS, lipopolysaccharide. + and – indicate with and without LPS (1 μg/mL) treatment, separately. One-way ANOVA was utilized to determine statistical significance. The results were displayed in a form of mean±SEM from 3 independent experiments. **p<0.01 relative to control group without LPS. ## p<0.01 relative to LPS group.

IQC reduced NO and PGE2 production within LPS-stimulated BV2 cells

NO and prostaglandin E2 (PGE2) act as major regulators of the inflammatory response, and excess NO and PGE2 is a hallmark of the LPS-induced inflammatory response. For determining IQC’s function in the NO and PGE2 generation in LPS-triggered BV2 cells, Griess chemical was used to test stabilized NO metabolite within cell medium, and the PGE2 production was measured by ELISA kit. LPS exposure substantially increased NO and PGE2 levels in the medium compared to the control without LPS, while IQC supplement significantly inhibited the increase in the two production in a manner of dose-dependent (Figure 2A). NO is synthesized by l-arginine catalyzed by nitric oxide synthase (iNOS) and secreted outside the cell. In the inflammatory state, PGE2 synthesis is mainly dependent on cyclooxygenase (COX2). By using RT-qPCR, we tested the mRNA levels of iNOS and COX2 for explaining IQC’s inhibition on the excessive generation of NO and PGE2. It was showed that IQC pretreatment significantly alleviated the elevated expression of iNOS and COX2 caused by LPS exposure (Figure 2B). In addition, as shown by WB, IQC pretreatment inhibited the LPS-induced COX2 and iNOS protein expression (Figure 2C). Our results demonstrated that IQC inhibited the production of inflammatory modulator NO in LPS-stimulated microglia.

Figure 2: IQC reduced NO and PGE2 production within LPS-stimulated BV2 cells. (A) Griess assay was performed to detect NO production within cell medium and PGE2 was measured by ELISA kit. (B) iNOS and COX2 mRNA expression was detected through RT-qPCR. (C) iNOS and COX2 protein expression was measured through WB assay. **p<0.01 relative to control group without LPS (n=3). #p<0.05, ## p<0.01 relative to LPS group.
Figure 2:

IQC reduced NO and PGE2 production within LPS-stimulated BV2 cells. (A) Griess assay was performed to detect NO production within cell medium and PGE2 was measured by ELISA kit. (B) iNOS and COX2 mRNA expression was detected through RT-qPCR. (C) iNOS and COX2 protein expression was measured through WB assay. **p<0.01 relative to control group without LPS (n=3). #p<0.05, ## p<0.01 relative to LPS group.

IQC inhibited LPS-induced inflammatory cytokine expression in BV2 cells

Apart from NO and PGE2, numerous inflammatory cytokines are also produced in excess in LPS-treated BV2 microglia. Herein, we further determined the expression of three common inflammatory factors TNF-α, IL-1β and IL-6 in LPS-triggered BV2 cells with/without IQC through RT-qPCR analysis. The results were similar to NO and PGE2 in that LPS increased the mRNA levels of TNF-α, IL-1β and IL-6 tens of times, indicating an activated inflammatory response. IQC significantly reduced the mRNA level of three inflammatory factors in a manner of dose-dependent, high dose of IQC reduced the mRNA levels of TNF-α, IL-1β and IL-6 by 2-fold, 4-fold and 4-fold, respectively (Figure 3A–C ).

Figure 3: IQC inhibited LPS-induced inflammatory cytokine expression in BV2 cells. After 24 h of IQC treatment, cells were exposed to 12 h of LPS treatment. TNF-α (A), IL-1β (B) and IL-6 (C) mRNA expression was measured through RT-qPCR analysis. The results were displayed in a form of mean±SEM from 3 independent experiments. **p<0.01 relative to control group without LPS. #p<0.05, ## p<0.01 relative to LPS group.
Figure 3:

IQC inhibited LPS-induced inflammatory cytokine expression in BV2 cells. After 24 h of IQC treatment, cells were exposed to 12 h of LPS treatment. TNF-α (A), IL-1β (B) and IL-6 (C) mRNA expression was measured through RT-qPCR analysis. The results were displayed in a form of mean±SEM from 3 independent experiments. **p<0.01 relative to control group without LPS. #p<0.05, ## p<0.01 relative to LPS group.

IQC inhibited LPS-mediated inflammatory response through the NF-κB pathway

As a main pathway involved in regulating inflammatory and immune responses, NF-κB signaling is tightly related to inflammatory factor levels. Therefore, we investigated whether the inhibitory effect of IQC on the inflammatory response was through the NF-κB signaling pathway. WB was employed to examine total protein levels and phosphorylated protein levels of IKK kinase (IKKα) and NF-κB subunit (p65). The results showed that IQC did not change the total protein levels of IKKα and p65, but inhibited the phosphorylation levels of both (Figure 4A and B). Phosphorylation of IKKα and p65 is critical for the activation of the NF-κB pathway, resulting in dissociation the NF-κB complex and nuclear translocation, which initiates downstream gene transcription and finally releases inflammatory factors. Our results suggest that IQC may affect the NF-κB pathway at the level of post-translational modifications rather than gene expression. Notably, intermediate dose of IQC (40 μg/mL) was sufficient to rescue the phosphorylated protein levels of IKKα and p65 in the activated state of BV2 cells to a level similar to that at rest (Figure 4B).

Figure 4: IQC inhibited LPS-mediated inflammatory response through the NF-κB pathway. (A) Representative images of WB assays for p-IKKα, IKKα, p65 and p-p65. (B) Quantification of proteins expression measured following different treatment. The results were displayed in a form of mean±SEM from 3 independent experiments. **p<0.01 relative to control group without LPS. #p<0.05, ## p<0.01 relative to LPS group.
Figure 4:

IQC inhibited LPS-mediated inflammatory response through the NF-κB pathway. (A) Representative images of WB assays for p-IKKα, IKKα, p65 and p-p65. (B) Quantification of proteins expression measured following different treatment. The results were displayed in a form of mean±SEM from 3 independent experiments. **p<0.01 relative to control group without LPS. #p<0.05, ## p<0.01 relative to LPS group.

IQC suppressed LPS-triggered inflammatory response via p38MAPK pathway

In addition to NF-κB, p38MAPK is also an important signaling pathway for inflammation production. The p38MAPK pathway includes molecules such as p38, ERK, and MEK. On the one hand, the activated p38MAPK signal induces the translocation of several transcription factors to the nucleus and thus initiates the transcription of some inflammatory factors. On the other hand, p38MAPK activates mitogen and stress-activated protein kinases MSK1 and MSK2, which phosphorylate the trans-activating p65 subunit at Ser276 thereby potentiating NF-κB signaling [24, 25]. We used WB to further explore the action on the p38MAPK pathway in LPS-stimulated microglia. Similar to NF-κB, IQC did not affect the expression of p38MAPK pathway components p38, ERK, and MEK, but significantly inhibited their phosphorylation levels (Figure 5A). The inhibitory effect of IQC on the p38MAPK pathway was dose-dependent, with higher doses of IQC (80 μg/mL) almost completely resisting LPS-induced p38MAPK activation in BV2 microglia (Figure 5A–D).

Figure 5: IQC suppressed LPS-Triggered inflammatory response via p38MAPK pathway. (A) Representative images of WB assays for p38, p-p38, ERK, p-ERK, MEK and p-MEK. (B) Quantification of proteins expression measured following different treatment. The results were displayed in a form of mean±SEM from 3 independent experiments. **p<0.01 relative to control group without LPS. #p<0.05, ## p<0.01 relative to LPS group.
Figure 5:

IQC suppressed LPS-Triggered inflammatory response via p38MAPK pathway. (A) Representative images of WB assays for p38, p-p38, ERK, p-ERK, MEK and p-MEK. (B) Quantification of proteins expression measured following different treatment. The results were displayed in a form of mean±SEM from 3 independent experiments. **p<0.01 relative to control group without LPS. #p<0.05, ## p<0.01 relative to LPS group.

Discussion

Our study was executed to explore IQC’s anti-inflammation on LPS-treated BV2 cells. Our data showed that IQC suppressed LPS-mediated inflammatory response through the NF-κB and p38MAPK pathways. Hence, IQC might be used as the candidate to treat neurodegenerative disorders.

In the present study, we firstly used MTT assay to confirm that IQC exposure had no influence on cell viability at different doses (20, 40, 80 μg/mL) after LPS treatment, indicating no cytotoxicity of IQC at the tested doses. Thereafter, we measured NO production within cell medium through the use of Griess chemicals. According to Figure 2A, compared with the control group without LPS, treatment with LPS promoted the expression of NO levels, while IQC treatment significantly decreased NO production in dose-dependent patterns. As reported, NO serves as the short-lived radical produced via iNOS; meanwhile, expression of COX2 increased plays a key role in inflammation. Consequently, we tested COX2 and iNOS levels through RT-qPCR and western blot. As a result, LPS treatment elevated two proteins and genes levels within BV2 cells relative to control, whereas IQC exposure inhibited the LPS-mediated up-regulation of iNOS and COX2 dose-dependently. Combined with findings in other cellular or animal models [16, 26], [27], [28], these data imply that IQC may have broad anti-inflammatory effects.

Microglia are widely distributed as macrophages throughout the CNS. Multiple microglia subtypes in an activated state have recently been identified in disease models and patients, and they are involved in neurodegenerative disease processes [29], [30], [31], [32], [33]. The activated microglia have two sides, one is beneficial, such as presenting antigen, phagocyte fragment, up regulating the receptor of the intrinsic cell surface and releasing anti-inflammatory factors to promote neural repair; on the other hand, activating microglia also generates the cytotoxic substances and pro-inflammatory cytokines, like NO, ROS, IL-1β, and TNF-α [34]. Our study showed that IQC can effectively resist the inflammatory response of microglia, which highlighted IQC as a promising candidate for neurodegenerative diseases.

Pro-inflammatory factors are related to immunocyte defense mechanism, but the excess production of these factors possibly results in immunopathological diseases [35, 36]. TNF-α, IL-6 and IL-1β belong to pro-inflammatory cytokine family, which usually secrete too much in the early stage and may further aggravate inflammation [37]. In the present study, LPS dramatically elevated TNF-α, IL-6 and IL-1β expression at mRNA level and relative to LPS group, IQC significantly inhibited this inflammatory cytokine production depending on its dose.

For better exploring the potential mechanisms underlying IQC’s inhibition on the LPS-activated BV2 cells, this study studied how IQC affected the associated signal transduction pathways, including p38MAPK and NF-κB signal transduction pathways. In this study, we adverted that LPS exposure markedly promoted NF-κB and IKKα phosphorylation, IQC treatment dramatically inhibited IKKα and NF-κB phosphorylation. In canonical NF-κB signal transduction pathway, stimulation like TNF-α and LPS potentially triggers the inhibitor of IκB kinase (IKK), which subsequently phosphorylates IκBα, leading to NF-κB dimer nuclear translocation [38, 39]. In addition, p38MAPK pathway had been revealed participating in salidroside-regulated cell viability of the LPS-stimulated BV2 microglia [40, 41]. In the present study, as revealed by our findings, LPS remarkably induced ERK1/2, MEK and p38 phosphorylation; IQC exposure decreased the LPS-mediated phosphorylation levels of MAPK family members, indicating that the IQC-regulated p38MAPK pathway represents the other effecter within LPS-treated BV2 microglial cells. Interestingly, IQC did not affect the expression of both pathways, but reduced their activity by reducing phosphorylation level. Such results suggest that IQC affects the activity of the anti-inflammatory pathway at the post-translational level.

Conclusions

The present study suggested that Isoquercitrin suppressed LPS-triggered inflammatory reaction may via NF-κB and p38MAPK signal transduction pathway within BV-2 microglia cells. The present work supported that Isoquercitrin might be used to treat disorders related to neural inflammation.

Corresponding author: Xuelian Huang, Department of Anesthesiology, 74567 Affiliated Hospital of Nantong University , Nantong 226001, Jiangsu Province, P.R. China, E-mail:

Funding source: Science and Technology Bureau of Nantong

Award Identifier / Grant number: JC2021085

Acknowledgments

The corresponding author thanks Keyue Cao from London Metropolitan University for her guidance on the manuscript writing.

  1. Research ethics: Not applicable.

  2. Informed consent: Informed consent was obtained from all individuals included in this study.

  3. Author contributions: The authors have accepted responsibility for the entire content of this manuscript and approved its submission.

  4. Competing interests: The authors state no conflict of interest.

  5. Research funding: This work was supported by the Science and Technology Bureau of Nantong (Grant No. JC2021085).

  6. Data availability: The raw data can be obtained on request from the corresponding author.

References

1. Subhramanyam, CS, Wang, C, Hu, Q, Dheen, ST. Microglia-mediated neuroinflammation in neurodegenerative diseases. Semin Cell Dev Biol 2019;94:112–20. https://doi.org/10.1016/j.semcdb.2019.05.004.Search in Google Scholar PubMed

2. Wolf, SA, Boddeke, HW, Kettenmann, H. Microglia in physiology and disease. Annu Rev Physiol 2017;79:619–43. https://doi.org/10.1146/annurev-physiol-022516-034406.Search in Google Scholar PubMed

3. Colonna, M, Butovsky, O. Microglia function in the central nervous system during health and neurodegeneration. Annu Rev Immunol 2017;35:441–68. https://doi.org/10.1146/annurev-immunol-051116-052358.Search in Google Scholar PubMed PubMed Central

4. Sun, J, Song, Y, Chen, Z, Qiu, J, Zhu, S, Wu, L, et al.. Heterogeneity and molecular markers for CNS glial cells revealed by single-cell transcriptomics. Cell Mol Neurobiol 2022;42:2629–42. https://doi.org/10.1007/s10571-021-01159-3.Search in Google Scholar PubMed

5. Leng, F, Edison, P. Neuroinflammation and microglial activation in alzheimer disease: where do we go from here? Nat Rev Neurol 2021;17:157–72. https://doi.org/10.1038/s41582-020-00435-y.Search in Google Scholar PubMed

6. Tang, Y, Le, W. Differential roles of M1 and M2 microglia in neurodegenerative diseases. Mol Neurobiol 2016;53:1181–94. https://doi.org/10.1007/s12035-014-9070-5.Search in Google Scholar PubMed

7. Kobashi, S, Terashima, T, Katagi, M, Nakae, Y, Okano, J, Suzuki, Y, et al.. Transplantation of M2-deviated microglia promotes recovery of motor function after spinal cord injury in mice. Mol Ther: J Am Soc Gene Ther 2020;28:254–65. https://doi.org/10.1016/j.ymthe.2019.09.004.Search in Google Scholar PubMed PubMed Central

8. Ciesielska, A, Matyjek, M, Kwiatkowska, K. TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling. Cell Mol Life Sci 2021;78:1233–61. https://doi.org/10.1007/s00018-020-03656-y.Search in Google Scholar PubMed PubMed Central

9. Wang, S, Luo, Q, Zhou, Y, Fan, P. CLG from hemp seed inhibits LPS-stimulated neuroinflammation in BV2 microglia by regulating NF-kappaB and Nrf-2 pathways. ACS Omega 2019;4:16517–23. https://doi.org/10.1021/acsomega.9b02168.Search in Google Scholar PubMed PubMed Central

10. Zhang, J, Zheng, Y, Luo, Y, Du, Y, Zhang, X, Fu, J. Curcumin inhibits LPS-induced neuroinflammation by promoting microglial M2 polarization via TREM2/TLR4/NF-kappaB pathways in BV2 cells. Mol Immunol 2019;116:29–37. https://doi.org/10.1016/j.molimm.2019.09.020.Search in Google Scholar PubMed

11. Badshah, H, Ali, T, Kim, MO. Osmotin attenuates LPS-induced neuroinflammation and memory impairments via the TLR4/NFkappaB signaling pathway. Sci Rep 2016;6. https://doi.org/10.1038/srep24493.Search in Google Scholar PubMed PubMed Central

12. Hoogland, IC, Houbolt, C, van Westerloo, DJ, van Gool, WA, van de Beek, D. Systemic inflammation and microglial activation: systematic review of animal experiments. J Neuroinflammation 2015;12:114. https://doi.org/10.1186/s12974-015-0332-6.Search in Google Scholar PubMed PubMed Central

13. Yang, X, Wang, G, Cao, T, Zhang, L, Ma, Y, Jiang, S, et al.. Large-conductance calcium-activated potassium channels mediate lipopolysaccharide-induced activation of murine microglia. J Biol Chem 2019;294:12921–32. https://doi.org/10.1074/jbc.ra118.006425.Search in Google Scholar PubMed PubMed Central

14. Djedjibegovic, J, Marjanovic, A, Panieri, E, Saso, L. Ellagic acid-derived urolithins as modulators of oxidative stress. Oxid Med Cell Longev 2020;2020. https://doi.org/10.1155/2020/5194508.Search in Google Scholar PubMed PubMed Central

15. Sheng, F, Zhang, L, Wang, S, Yang, L, Li, P. Deacetyl ganoderic acid F inhibits LPS-induced neural inflammation via NF-kappaB pathway both in vitro and in vivo. Nutrients 2019;12. https://doi.org/10.3390/nu12010085.Search in Google Scholar PubMed PubMed Central

16. Jayachandran, M, Wu, Z, Ganesan, K, Khalid, S, Chung, SM, Xu, B. Isoquercetin upregulates antioxidant genes, suppresses inflammatory cytokines and regulates AMPK pathway in streptozotocin-induced diabetic rats. Chem Biol Interact 2019;303:62–9. https://doi.org/10.1016/j.cbi.2019.02.017.Search in Google Scholar PubMed

17. Wang, CP, Shi, YW, Tang, M, Zhang, XC, Gu, Y, Liang, XM, et al.. Isoquercetin ameliorates cerebral impairment in focal ischemia through anti-oxidative, anti-inflammatory, and anti-apoptotic effects in primary culture of rat hippocampal neurons and hippocampal CA1 region of rats. Mol Neurobiol 2017;54:2126–42. https://doi.org/10.1007/s12035-016-9806-5.Search in Google Scholar PubMed

18. Qiu, J, Yang, X, Wang, L, Zhang, Q, Ma, W, Huang, Z, et al.. Isoquercitrin promotes peripheral nerve regeneration through inhibiting oxidative stress following sciatic crush injury in mice. Ann Transl Med 2019;7:680. https://doi.org/10.21037/atm.2019.11.18.Search in Google Scholar PubMed PubMed Central

19. Owczarek-Januszkiewicz, A, Magiera, A, Olszewska, MA. Enzymatically modified isoquercitrin: production, metabolism, bioavailability, Toxicity, pharmacology, and related molecular mechanisms. Int J Mol Sci 2022;23. https://doi.org/10.3390/ijms232314784.Search in Google Scholar PubMed PubMed Central

20. Bondonno, NP, Bondonno, CP, Ward, NC, Woodman, RJ, Hodgson, JM, Croft, KD. Enzymatically modified isoquercitrin improves endothelial function in volunteers at risk of cardiovascular disease. Br J Nutr 2020;123:182–9. https://doi.org/10.1017/s0007114519002137.Search in Google Scholar

21. Waheed, G, Ramadan, G, Mohammed, HA. Sodium R-lipoate and enzymatically-modified isoquercitrin suppressed IgE-independent anaphylactic reactions and stress-induced gastric ulceration in mice. Int Immunopharmacol 2021;97. https://doi.org/10.1016/j.intimp.2021.107735.Search in Google Scholar PubMed

22. Okano, H, Takashima, K, Takahashi, Y, Ojiro, R, Tang, Q, Ozawa, S, et al.. Ameliorating effect of continuous alpha-glycosyl isoquercitrin treatment starting from late gestation in a rat autism model induced by postnatal injection of lipopolysaccharides. Chem Biol Interact 2022;351. https://doi.org/10.1016/j.cbi.2021.109767.Search in Google Scholar PubMed

23. Valentova, K, Vrba, J, Bancirova, M, Ulrichova, J, Kren, V. Isoquercitrin: pharmacology, toxicology, and metabolism. Food Chem Toxicol 2014;68:267–82. https://doi.org/10.1016/j.fct.2014.03.018.Search in Google Scholar PubMed

24. Salminen, A, Kauppinen, A, Kaarniranta, K. Emerging role of NF-kappaB signaling in the induction of senescence-associated secretory phenotype (SASP). Cell Signal 2012;24:835–45. https://doi.org/10.1016/j.cellsig.2011.12.006.Search in Google Scholar PubMed

25. Bonney, EA. Mapping out p38MAPK. Am J Reprod Immunol 2017;77. https://doi.org/10.1111/aji.12652.Search in Google Scholar PubMed PubMed Central

26. Shi, Y, Chen, X, Liu, J, Fan, X, Jin, Y, Gu, J, et al.. Isoquercetin improves inflammatory response in rats following ischemic stroke. Front Neurosci 2021;15. https://doi.org/10.3389/fnins.2021.555543.Search in Google Scholar PubMed PubMed Central

27. Chen, S, Wu, F, Yang, C, Zhao, C, Cheng, N, Cao, W, et al.. Alternative to sugar, honey does not provoke insulin resistance in rats based on lipid profiles, inflammation, and IRS/PI3K/AKT signaling pathways modulation. J Agric Food Chem 2022;70:10194–208. https://doi.org/10.1021/acs.jafc.2c03639.Search in Google Scholar PubMed

28. Kim, EH, Shim, YY, Lee, HI, Lee, S, Reaney, MJT, Chung, MJ. Astragalin and isoquercitrin isolated from aster scaber suppress LPS-induced neuroinflammatory responses in microglia and mice. Foods 2022;11. https://doi.org/10.3390/foods11101505.Search in Google Scholar PubMed PubMed Central

29. Olah, M, Menon, V, Habib, N, Taga, MF, Ma, Y, Yung, CJ, et al.. Single cell RNA sequencing of human microglia uncovers a subset associated with alzheimer’s disease. Nat Commun 2020;11:6129. https://doi.org/10.1038/s41467-020-19737-2.Search in Google Scholar PubMed PubMed Central

30. Sun, J, Qiu, J, Yang, Q, Ju, Q, Qu, R, Wang, X, et al.. Single-cell RNA sequencing reveals dysregulation of spinal cord cell types in a severe spinal muscular atrophy mouse model. PLoS Genet 2022;18:e1010392. https://doi.org/10.1371/journal.pgen.1010392.Search in Google Scholar PubMed PubMed Central

31. Smajic, S, Prada-Medina, CA, Landoulsi, Z, Ghelfi, J, Delcambre, S, Dietrich, C, et al.. Single-cell sequencing of human midbrain reveals glial activation and a Parkinson-specific neuronal state. Brain 2022;145:964–78. https://doi.org/10.1093/brain/awab446.Search in Google Scholar PubMed PubMed Central

32. Absinta, M, Maric, D, Gharagozloo, M, Garton, T, Smith, MD, Jin, J, et al.. A lymphocyte-microglia-astrocyte axis in chronic active multiple sclerosis. Nature 2021;597:709–14. https://doi.org/10.1038/s41586-021-03892-7.Search in Google Scholar PubMed PubMed Central

33. Malaiya, S, Cortes-Gutierrez, M, Herb, BR, Coffey, SR, Legg, SRW, Cantle, JP, et al.. Single-nucleus RNA-seq reveals dysregulation of striatal cell identity due to huntington’s disease mutations. J Neurosci 2021;41:5534–52. https://doi.org/10.1523/jneurosci.2074-20.2021.Search in Google Scholar PubMed PubMed Central

34. Nam, HY, Nam, JH, Yoon, G, Lee, JY, Nam, Y, Kang, HJ, et al.. Ibrutinib suppresses LPS-induced neuroinflammatory responses in BV2 microglial cells and wild-type mice. J Neuroinflammation 2018;15:271. https://doi.org/10.1186/s12974-018-1308-0.Search in Google Scholar PubMed PubMed Central

35. Vila, N, Castillo, J, Davalos, A, Chamorro, A. Proinflammatory cytokines and early neurological worsening in ischemic stroke. Stroke 2000;31:2325–9. https://doi.org/10.1161/01.str.31.10.2325.Search in Google Scholar PubMed

36. Wang, CX, Shuaib, A. Involvement of inflammatory cytokines in central nervous system injury. Prog Neurobiol 2002;67:161–72. https://doi.org/10.1016/s0301-0082(02)00010-2.Search in Google Scholar PubMed

37. Zhang, Y, Yuan, L, Chen, Y, Lin, C, Ye, G. Oxyntomodulin attenuates TNFalpha induced neuropathic pain by inhibiting the activation of the NFkappaB pathway. Mol Med Rep 2019;20:5223–8. https://doi.org/10.3892/mmr.2019.10770.Search in Google Scholar PubMed

38. Jayasooriya, RG, Lee, KT, Lee, HJ, Choi, YH, Jeong, JW, Kim, GY. Anti-inflammatory effects of beta-hydroxyisovalerylshikonin in BV2 microglia are mediated through suppression of the PI3K/Akt/NF-kB pathway and activation of the Nrf2/HO-1 pathway. Food Chem Toxicol 2014;65:82–9. https://doi.org/10.1016/j.fct.2013.12.011.Search in Google Scholar PubMed

39. Guo, M, Li, Z, Huang, Y, Shi, M. Polysaccharides from nostoc commune Vaucher activate macrophages via NF-kappaB and AKT/JNK1/2 pathways to suppress colorectal cancer growth in vivo. Food Funct 2019;10:4269–79. https://doi.org/10.1039/c9fo00595a.Search in Google Scholar PubMed

40. Xu, J, Yuan, C, Wang, G, Luo, J, Ma, H, Xu, L, et al.. Urolithins attenuate LPS-induced neuroinflammation in BV2Microglia via MAPK, akt, and NF-kappaB signaling pathways. J Agric Food Chem 2018;66:571–80. https://doi.org/10.1021/acs.jafc.7b03285.Search in Google Scholar PubMed

41. Kim, DC, Quang, TH, Oh, H, Kim, YC, Correction, Kim, D-C, et al.. Steppogenin isolated from cudrania tricuspidata shows antineuroinflammatory effects via NF-kappaB and MAPK pathways in LPS-stimulated BV2 and primary rat microglial cells. Molecules 2017, 22, 2130. Molecules 2018;23.10.3390/molecules23061244Search in Google Scholar PubMed PubMed Central

Received: 2023-05-16
Accepted: 2023-11-17
Published Online: 2024-08-06

© 2024 the author(s), published by De Gruyter, Berlin/Boston

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Frontmatter
  2. Review
  3. BDNF-altering cell death mechanisms of brain disorders: pyroptosis and/or ferroptosis? A systematic review
  4. Research Articles
  5. Evaluation of the implementation of the rational use of laboratory tests in the clinical chemistry laboratory
  6. Right vagotomy alters heart rate variability temporarily and increases total choline levels in rats
  7. Utilizing cell population data for diagnosis and intensive care unit requirement prediction in Fournier gangrene patients
  8. Evaluation of adropin indices and PCSK9 in non-diabetic men with severe obstructive sleep apnea
  9. The effect of curcumin on PI3K/Akt and AMPK pathways in insulin resistance induced by fructose
  10. Isoquercitrin attenuates neuroinflammation in LPS-stimulated BV2 microglia cells via p38MAPK/NF-κB pathway
  11. In vitro and in silico investigations of the pro-apoptotic activity of Opuntia ficus-indica cladode extracts against K562 cells
  12. Human estrogen receptor alpha (ERα) targeted cyclic peptides inhibit cell growth and induce apoptosis in MCF-7 cells
  13. Differential effects of choline on TLR2/4 mediated signaling through possible regulation of Toll-interacting protein in hepatocellular carcinoma cell lines
  14. Determination of molecular pathways and gene ontology of genes associated with Raynaud’s phenomenon
  15. Joint effects of PPARG-C161T (rs3856806) polymorphism and cardiovascular risk factors on restenosis risk after coronary stent implantation
  16. CXCL12/CXCR4 as a potential axis in diagnosis and predicting disease severity in COVID-19 patients: a new perspective
  17. Investigation of the effect of low-power, low-frequency ultrasound application on SARS-COV-2
https://doi.org/10.1515/tjb-2023-0108
Keywords for this article
isoquercitrin; neuroinflammation; BV2; NF-κB and MAPK signaling
Creative Commons
BY 4.0

Articles in the same Issue

  1. Frontmatter
  2. Review
  3. BDNF-altering cell death mechanisms of brain disorders: pyroptosis and/or ferroptosis? A systematic review
  4. Research Articles
  5. Evaluation of the implementation of the rational use of laboratory tests in the clinical chemistry laboratory
  6. Right vagotomy alters heart rate variability temporarily and increases total choline levels in rats
  7. Utilizing cell population data for diagnosis and intensive care unit requirement prediction in Fournier gangrene patients
  8. Evaluation of adropin indices and PCSK9 in non-diabetic men with severe obstructive sleep apnea
  9. The effect of curcumin on PI3K/Akt and AMPK pathways in insulin resistance induced by fructose
  10. Isoquercitrin attenuates neuroinflammation in LPS-stimulated BV2 microglia cells via p38MAPK/NF-κB pathway
  11. In vitro and in silico investigations of the pro-apoptotic activity of Opuntia ficus-indica cladode extracts against K562 cells
  12. Human estrogen receptor alpha (ERα) targeted cyclic peptides inhibit cell growth and induce apoptosis in MCF-7 cells
  13. Differential effects of choline on TLR2/4 mediated signaling through possible regulation of Toll-interacting protein in hepatocellular carcinoma cell lines
  14. Determination of molecular pathways and gene ontology of genes associated with Raynaud’s phenomenon
  15. Joint effects of PPARG-C161T (rs3856806) polymorphism and cardiovascular risk factors on restenosis risk after coronary stent implantation
  16. CXCL12/CXCR4 as a potential axis in diagnosis and predicting disease severity in COVID-19 patients: a new perspective
  17. Investigation of the effect of low-power, low-frequency ultrasound application on SARS-COV-2
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 17.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/tjb-2023-0108/html
Scroll to top button