Abstract
Objectives
A small subpopulation of colorectal cancer stem cells (CSCs) possess the ability to self-renew and the capacity to initiate the original tumor. EpCAMhigh/CD44+ cells are regarded as CSCs in colorectal cancer. The present study was undertaken to investigate the significance of EpCAM in the in vitro proliferation ability and oxaliplatin chemoresistance of EpCAMhigh/CD44+ colorectal CSCs.
Methods
We applied fluorescence-activated cell sorting (FACS) to separate the EpCAMhigh/CD44+ subset from human colorectal cancer cell line HCT116. We also used siRNA targeting EpCAM to create EpCAM−/CD44+ subpopulation. Then we compared EpCAMhigh/CD44+ cells and EpCAM−/CD44+ cells for proliferation ability and the chemoresistance to oxaliplatin by CCK8 assay.
Results
The EpCAMhigh/CD44+ subset comprises almost 6.25 ± 0.09% in cell line HCT116, and the EpCAM−/CD44+ cells displayed a significantly lower proliferation ability and weaker oxaliplatin chemoresistance than the EpCAMhigh/CD44+ cells.
Conclusions
EpCAM is critical for tumor proliferation and oxaliplatin chemoresistance in EpCAMhigh/CD44+ colorectal CSCs.
Introduction
The prevalence of colorectal cancer increases with age, and it is the 3rd most commonly diagnosed cancer in developed countries [1]. The significant risk factors of colorectal cancer are contributed by the increasingly ageing population, unfavorable modern dietary habits, low physical exercise, obesity, and smoking [2]. Surgery can be applied to remove tumors in almost 2/3 of patients with colorectal cancer that is localized. Radiation therapy is used to cure about 20% of patients with colorectal cancer, which has spread to other organs, most commonly to the liver [3]. Patients with cancer recurrence can be treated with surgery, and chemotherapy is still the primary therapeutic method for advanced colorectal cancer [4, 5]. There has been substantial progress in the treatment of colorectal cancer recently [6].
Colorectal carcinomas consist of heterogeneous cells [7]. Colorectal cancer stem cells (CSC) have gained great attraction due to their high tumorigenicity and chemoresistance. Many studies have shown that three key pathways play a crucial role in stem cell proliferation and maintenance: the Notch pathway, the WNT pathway, and the bone morphogenetic protein (BMP) pathway [8], [9], [10]. Recent studies revealed molecular signatures of colorectal CSCs are associated with patient outcomes. Some CSC-directed therapies are being performed on patients to translate CSC discoveries into the clinics [11].
Several markers are used for colorectal CSC identification, such as epithelial cell adhesion molecule (EpCAM) [12], CD44 [13], CD166 [14], aldehyde dehydrogenase-1 (ALDH-1) [15] and CD26 [16]. EpCAMhighCD44+ colorectal CSCs are considered putative colorectal CSCs rich in stem cell genes [17]. However, the significance of EpCAM in the in vitro proliferation ability and oxaliplatin chemoresistance of EpCAMhighCD44+ colorectal CSCs is elusive. Therefore, this study is to elucidate the great value of EpCAM in EpCAMhighCD44+ colorectal CSCs to provide the theoretical foundation for EpCAM-targeted therapies in the future.
Materials and methods
Chemical
A 1 g/L stock solution of Oxaliplatin (Sigma, China) was prepared in a 5% glucose solution, which was diluted by RPMI-1640 medium (Gibco, USA) to make a working solution.
Cell culture
The human colorectal cancer cell lines (HCT116) were obtained from the Institute of Biophysics, Chinese Academy of Sciences. HCT116 cells were cultured in RPMI-1640 medium (Gibco, USA) supplemented with 10% Fetal Bovine Serum (FBS) (Gibco, USA) and 1% streptomycin and penicillin (Sigma, China), which were maintained in an incubator supplied with 5% CO2 at 37 °C.
Flow cytometry sorting
After washing with Phosphate buffer solutions (PBS), HCT116 cells were stained with FITC-conjugated anti-CD44 and APC-conjugated anti-EpCAM antibodies for 30 min on ice. The BD FACS Aria III cell sorter was applied to analyze and isolate the EPCAMhigh/CD44+ cells.
Gene silencing of EpCAM
The mismatched control and the siRNA targeting human EpCAM were designed and synthesized from RiboBio (Guangzhou, China). Mismatched control siRNA sequences were as follows: sense, UUCUCCGAACGUGUCACGUdTdT; antisense, ACGUGACACGUUCGGAGAAdTdT. The siRNA sequences for EPCAM were as follows: sense, CAATGCCAGTGTACTTCAGTT; antisense, AACTGAAGTACACTGGCATTG. After HCT116 was transfected with 16.7 nM annealed negative mismatched control siRNA or siRNA targeting human EPCAM in OPTI media, a siRNA-mate reagent (Genepharma, Shanghai, China) was used as the transfection reagent based on the manufacturer’s instruction.
RT-PCR
An RNA purification kit (New England Biolabs, USA) was used to isolate total RNA based on the manufacturer’s instructions. A PrimeScript RT Reagent Kit (TaKaRa, Japan) was chosen to perform reverse transcription (RT). ChamQ Universal SYBR qPCR Master Mix (Vazyme, China) was applied to perform a real-time polymerase chain reaction (PCR). LightCycler 96 System (Roche, Switzerland) was selected to carry out PCR amplification and fluorescence detection. β-Actin was chosen as the internal control. The CT method (2−ΔΔCT) was applied to calculate comparative expression ratios of the target sample to the control group for each sample. The primers for RT-PCR are in Table 1.
| Gene name | Gene sequence | |
|---|---|---|
| EpCAM | Forward | 5′ GTTCGGGCTTCTGCT 3′ |
| Reverse | 5′ CATTTCTGCCTTCATCAC 3′ | |
| β-Actin | Forward | 5′ ACTCTTCCAGCCTTCCTTCC 3′ |
| Reverse | 5′ CAATGCCAGGGTACATGGTG3′ |
Western blotting
Whole proteins were extracted from HCT116 cells. Thirty mg of protein from each group was separated on a 10% sodium dodecyl sulfate (SDS)-polyacrylamide electrophoresis gel, then transferred to a polyvinylidene difluoride membrane. Firstly, the membrane was blocked with 5% nonfat dry milk diluted in Tris-buffered saline, then incubated with mouse anti-human EpCAM monoclonal antibody (ABCAM, USA) or mouse anti-human beta Actin monoclonal antibody (ZSGB-BIO, Beijing, CN). Subsequently, a horseradish peroxidase-linked anti-mouse IgG antibody (ZSGB-BIO, Beijing, CN) was incubating the membranes. Protein bands were visualized by a chemiluminescence horseradish peroxidase (HRP) substrate (Millipore, USA) and analyzed by ImageJ software.
The assay to test the proliferation ability
A CCK8 kit (Biyuntian Biological Technology Co., LTD, China) was used to compare the proliferation ability of EpCAMhigh/CD44+ and EPCAM−/CD44+ HCT116 cells. 1 × 103 cells were cultured into each well of a 96-welate for 24 h, and the old medium was removed. Then 10 μL CCK8 in a 90 μL new medium was added to each well, which was cultured for another 4. A multimode plate reader (EnSpire, USA) was selected to calculate the cell viability based on the absorbance at 450nm. The detection time was set at 0day, 1 day, 2 day, 3 day, 4 day, and 5 day.
The assay to test the chemoresistance
A CCK8 kit (Biyuntian Biological Technology Co., LTD, China) was used to compare the chemoresistance of EpCAMhigh/CD44+ and EpCAM−/CD44+ HCT116 cells. The cells were seeded into the 96 well plates, and the cells were treated with 2, 4, 8, 16, 32, or 64 mg/L Oxaliplatin for 24 h. Then the old medium was removed, and 10 μL CCK8 in 90 μL medium was added to each well, which was cultured for another 4. A multimode plate reader (EnSpire, USA) was used to calculate the cell viability based on the absorbance at 450nm.
Statistical analysis
Statistical difference was analyzed by GraphPad Prism version 7.0 (GraphPad Software Inc., California, USA). The statistical significance of the data from three independent experiments was analyzed by Student’s t-test, which is presented as the mean ± SD (standard deviation). p<0.05 or p<0.01 was considered statistically significant.
Results
The proportion of the EpCAMhigh/CD44+ subset in the human colorectal cancer cell line HCT116
The EpCAMhigh/CD44+ cells are regarded as colorectal CSCs. Anti-CD44 and anti-EPCAM antibodies were used to separate EpCAMhigh/CD44+ subpopulation from the human colorectal cancer cell line HCT116 (Figure 1), which comprises 6.25 ± 0.09% of the whole cell number.

The proportion of the EpCAMhigh/CD44+ subset in the human colorectal cancer cell line HCT116.
The EpCAM silencing efficacy in the EpCAMhigh/CD44+ cells
The EpCAMhigh/CD44+ cells were treated with siRNA targeting EpCAM, RT-PCR was used to detect the mRNA levels of EpCAM, and Western Blotting was applied to evaluate the protein levels of EpCAM. As shown in Figure 2A,B, the mRNA and protein levels of EpCAMdecreased significantly after the treatment of EpCAMhigh/CD44+ cells with siRNA targeting EpCAM.

The EpCAM silencing efficacy in the EpCAMhigh/CD44+ HCT116 cells(A) Western blot analysis of EPCAM level in the EpCAMhigh/CD44+ HCT116 cells treated with control, mm siRNA or EpCAM siRNA (B) semi-quantitative analysis of EpCAM mRNA levels detected by real-time RT-PCR analysis and (C) semi-quantitative analysis of EpCAM protein levels detected by Western lotting. *p<0.05, **p<0.01 vs. control group.
The comparison between EpCAMhigh/CD44+ cells and EpCAM−/CD44+ cells in proliferation ability
To evaluate the significance of EpCAM in the proliferation ability of EpCAMhigh/CD44+ cells, a CCK8 assay was applied to compare the proliferation ability of EpCAM−/CD44+ cells with EpCAMhigh/CD44+ cells at 0day, 1day, 2day, 3day, 4day and 5day. According to Figure 3, EpCAM−/CD44+ cells showed a significantly lower proliferation ability than EpCAMhigh/CD44+ cells.

Comparation EpCAM−/CD44+ HCT116 cells with EpCAMhigh/CD44+ HCT116 cells for the proliferation ability. **p<0.01 vs. control group.
The comparison between EpCAMhigh/CD44+ cells and EpCAM−/CD44+ cells in the chemoresistance
To determine the significance of EpCAM in chemoresistance, CCK8 assay was applied to compare the chemoresistance of EpCAM−/CD44+ cells with EpCAMhigh/CD44+ cells after treatment with different concentrations of oxaliplatin (2, 4, 8, 16 or 64 mg/L) for 24, 48 or 72 h. The results in Figure 4A–C revealed that EpCAM−/CD44+ cells showed a significantly lower oxaliplatin chemoresistance than EpCAMhigh/CD44+ cells control.

Comparation EpCAM−/CD44+ HCT116 cells and EpCAMhigh/CD44+ HCT116 cells for the oxaliplatin chemoresistance after 24 (A), 48 (B) and 72 (C) hours. *p<0.05, **p<0.01 vs. control group.
Discussion
About 945,000 patients are diagnosed with colorectal cancer, and almost 492,000 patients die from this disease globally each year [18]. The new molecular basis of colorectal cancer has resulted in the emergence of targeted therapeutic methods tested in clinics. Recent research has highlighted that colorectal CSCs play a crucial role in cancer chemoresistance and relapse. Targeting colorectal CSCs through monoclonal antibodies or small molecule inhibitors in vivo studies has demonstrated the effectiveness of these treatments [11]. CD44 is a multifunctional glycoprotein present on the cell surface, and EpCAM is an epithelial cell adhesion molecule [19, 20]. Some investigations suggested that EpCAMhigh/CD44+ cells are considered as CSCs in colorectal cancer [21].
This study applied fluorescence-activated cell sorting (FACS) to separate the EPCAMhigh/CD44+ subset from human colorectal cancer cell line HCT116. After quantifying the average proportion of the EPCAMhigh/CD44+ cells in the cell line HCT116, we used siRNA targeting EpCAM to create EpCAM−/CD44+ subpopulation. Subsequently, we compared EPCAMhigh/CD44+ cells and EpCAM−/CD44+ cells for proliferation ability and the chemoresistance to oxaliplatin. Our results suggested that the EpCAMhigh/CD44+ subset comprises almost 6.25 ± 0.09% cell line HCT116. It also turned out that the EpCAM−/CD44+ cells displayed a significantly lower proliferation ability and weaker oxaliplatin chemoresistance than the EPCAMhigh/CD44+ cells.
The preliminary result of this research will emphasize the significance of EpCAM in the EPCAMhigh/CD44+ cells to act as a potential target in curing colorectal cancer in the coming years. Antibodies (catumaxomab or edrecolomab) binding to EpCAM combined with oxaliplatin might be a novel method to eliminate EPCAMhigh/CD44+ cells [22], which will increase the overall survival rates for patients with colorectal cancer. This is sure to reduce the dose of oxaliplatin and improve the patients’ quality of life due to the limited toxicity.
This study has one limitation: we didn’t explore the detailed mechanism at the cellular level. We didn’t compare EPCAMhigh/CD44+ cells and EpCAM−/CD44+ cells for the tumorigenicity and oxaliplatin chemoresistance in tumor xenograft models. Thus, we need to perform further cell experiments to investigate the molecular mechanism and validate its effect on animal models.
In summary, EpCAM is critical for tumor proliferation, and oxaliplatin chemoresistance in EpCAMhigh/CD44+ colorectal CSCs, which indicates targeting EpCAM may be a method to eliminate EPCAMhigh/CD44+ cells to cure patients with colorectal cancer.
References
1. Thanikachalam, K, Khan, G. Colorectal cancer and nutrition. Nutrients 2019;11:164. https://doi.org/10.3390/nu11010164.Search in Google Scholar PubMed PubMed Central
2. Patel, SG, Ahnen, DJ. Colorectal cancer in the young. Curr Gastroenterol Rep 2018;20:1–2. https://doi.org/10.1007/s11894-018-0618-9.Search in Google Scholar PubMed
3. Haraldsdottir, S, Einarsdottir, HM, Smaradottir, A, Gunnlaugsson, A, Halfdanarson, TR. Colorectal cancer-review. Laeknabladid 2014;100:75–82. https://doi.org/10.17992/lbl.2014.02.531.Search in Google Scholar PubMed
4. Devoto, L, Celentano, V, Cohen, R, Khan, J, Chand, M. Colorectal cancer surgery in the very elderly patient: a systematic review of laparoscopic versus open colorectal resection. Int J Colorectal Dis 2017;32:1237–42. https://doi.org/10.1007/s00384-017-2848-y.Search in Google Scholar PubMed
5. Fujita, S, Kotake, K. Chemotherapy. Nihon Rinsho 2014;72:102–7.Search in Google Scholar
6. Anania, G, Resta, G, Marino, S, Fabbri, N, Scagliarini, L, Marchitelli, I, et al.. Treatment of colorectal cancer: a multidisciplinary approach. J Gastrointest Cancer 2019;50:458–68. https://doi.org/10.1007/s12029-018-0100-9.Search in Google Scholar PubMed
7. Sagaert, X, Vanstapel, A, Verbeek, S. Tumor heterogeneity in colorectal cancer: what do we know so far. Pathobiology 2018;85:72–84. https://doi.org/10.1159/000486721.Search in Google Scholar PubMed
8. Clevers, H. Wnt/β-catenin signaling in development and disease. Cell 2006;127:469–80. https://doi.org/10.1016/j.cell.2006.10.018.Search in Google Scholar PubMed
9. Sikandar, SS, Pate, KT, Anderson, S, Dizon, D, Edwards, RA, Waterman, ML, et al.. NOTCH signaling is required for the formation and self-renewal of tumor-initiating cells and repression of secretory cell differentiation in colon cancer. Cancer Res 2010;70:1469–78. https://doi.org/10.1158/0008-5472.can-09-2557.Search in Google Scholar
10. Zeuner, A, Todaro, M, Stassi, G, De Maria, R. Colorectal cancer stem cells: from the crypt to the clinic. Cell Stem Cell 2014;15:692–705. https://doi.org/10.1016/j.stem.2014.11.012.Search in Google Scholar PubMed
11. Gupta, R, Bhatt, LK, Johnston, TP, Prabhavalkar, KS. Colon cancer stem cells: potential target for the treatment of colorectal cancer. Cancer Biol Ther 2019;20:1068–82. https://doi.org/10.1080/15384047.2019.1599660.Search in Google Scholar PubMed PubMed Central
12. Dalerba, P, Dylla, SJ, Park, IK, Liu, R, Wang, X, Cho, RW, et al.. Phenotypic characterization of human colorectal cancer stem cells. Proc Natl Acad Sci Unit States Am 2007;104:10158–63. https://doi.org/10.1073/pnas.0703478104.Search in Google Scholar
13. Yeung, TM, Gandhi, SC, Wilding, JL, Muschel, R, Bodmer, WF. Cancer stem cells from colorectal cancer-derived cell lines. Proc Natl Acad Sci Unit States Am 2010;107:3722–7. https://doi.org/10.1073/pnas.0915135107.Search in Google Scholar
14. Weichert, W, Knösel, T, Bellach, J, Dietel, M, Kristiansen, G. ALCAM/CD166 is overexpressed in colorectal carcinoma and correlates with shortened patient survival. J Clin Pathol 2004;57:1160–4. https://doi.org/10.1136/jcp.2004.016238.Search in Google Scholar
15. Chen, Y, Orlicky, DJ, Matsumoto, A, Singh, S, Thompson, DC, Vasiliou, V. Aldehyde dehydrogenase 1B1 (ALDH1B1) is a potential biomarker for human colon cancer. Biochem Biophys Res Commun 2011;405:173–9. https://doi.org/10.1016/j.bbrc.2011.01.002.Search in Google Scholar
16. Pang, R, Law, WL, Chu, AC, Poon, JT, Lam, CS, Chow, AK, et al.. A subpopulation of CD26+ cancer stem cells with metastatic capacity in human colorectal cancer. Cell Stem Cell 2010;6:603–15. https://doi.org/10.1016/j.stem.2010.04.001.Search in Google Scholar
17. Liu, M, Di, J, Liu, Y, Su, Z, Jiang, B, Wang, Z, et al.. Comparison of EpCAMhighCD44+ cancer stem cells with EpCAMhighCD44− tumor cells in colon cancer by single-cell sequencing. Cancer Biol Ther 2018;19:939–47. https://doi.org/10.1080/15384047.2018.1456605.Search in Google Scholar
18. Weitz, J, Koch, M, Debus, J, Höhler, T, Galle, PR, Büchler, MW. Colorectal cancer. Lancet 2005;365:153–65. https://doi.org/10.1016/s0140-6736(05)17706-x.Search in Google Scholar
19. Sankpal, NV, Mayfield, JD, Willman, MW, Fleming, TP, Gillanders, WE. Activator protein 1 (AP-1) contributes to EpCAM-dependent breast cancer invasion. Breast Cancer Res 2011;13:1–3. https://doi.org/10.1186/bcr3070.Search in Google Scholar PubMed PubMed Central
20. Jaggupilli, A, Elkord, E. Significance of CD44 and CD24 as cancer stem cell markers: an enduring ambiguity. Clin Dev Immunol 2012;2012:708036. https://doi.org/10.1155/2012/708036.Search in Google Scholar PubMed PubMed Central
21. Tamura, S, Isobe, T, Ariyama, H, Nakano, M, Kikushige, Y, Takaishi, S, et al.. E-cadherin regulates proliferation of colorectal cancer stem cells through NANOG. Oncol Rep 2018;40:693–703. https://doi.org/10.3892/or.2018.6464.Search in Google Scholar PubMed PubMed Central
22. Kurtz, JE, Dufour, P. Adecatumumab: an anti-EpCAM monoclonal antibody, from the bench to the bedside. Expet Opin Biol Ther 2010;10:951–8. https://doi.org/10.1517/14712598.2010.482098.Search in Google Scholar PubMed
© 2022 the author(s), published by De Gruyter, Berlin/Boston
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Frontmatter
- Editorial
- COP27 climate change conference: urgent action needed for Africa and the world
- Review Article
- Clinical laboratory use of liquid chromatography mass spectrometry
- Research Articles
- Verification of enzymatic ethanol analysis method and method comparison with headspace gas chromatography
- Investigation of GHRL (rs4684677), FTO (rs8044769) and PGC1Α (rs8192678) polymorphisms in type 2 diabetic Turkish population
- Roles of OLR1 and IL17A variants on clinical phenotypes of Turkish patients undergoing coronary artery bypass surgery
- Cytokine gene polymorphism frequencies in Turkish population living in Marmara region
- Evaluation of BRCA1/2 gene mutations in patients with high-risk breast and/or ovarian cancer in Turkey
- Impacts of long noncoding RNA MALAT1 on LPS-induced periodontitis via modulating miR-155/SIRT1 axis
- Proteomics characterization of the adenovirus VA1 non-coding RNA on the landscape of cellular proteome
- Modulatory effect of pomegranate extract on TRPA1, TRPM2 and caspase-3 expressions in colorectal cancer induction of mice
- EpCAM is critical for tumor proliferation and oxaliplatin chemoresistance in EpCAMhigh/CD44+ colorectal cancer stem cells
- Prognostic factors in thrombotic thrombocytopenic purpura
- Possible effects of clinoptilolite on small intestinal ischemia-reperfusion injury caused by experimental mesenteric artery occlusion
- The relationship between pregnancies complicated with fetal growth restriction and umbilical cord blood endocan concentrations
- Sildenafil for the treatment of necrotizing enterocolitis: an experimental study
- The importance of LDH/Albumin, LDH/Lymphocyte, and LDH/Platelet ratios in the evaluation of COVID-19 B.1.1.7 variant
- The relationship between serum vitamin D and antibody response following two doses of inactivated COVID-19 vaccine
- The relationship between plasminogen activator inhibitor-1 levels and the course of disease in COVID-19 patients
- Could tear be an alternative specimen for SARS-CoV-2 detection?
- Case Report
- A case of falsely elevated D-dimer result
Articles in the same Issue
- Frontmatter
- Editorial
- COP27 climate change conference: urgent action needed for Africa and the world
- Review Article
- Clinical laboratory use of liquid chromatography mass spectrometry
- Research Articles
- Verification of enzymatic ethanol analysis method and method comparison with headspace gas chromatography
- Investigation of GHRL (rs4684677), FTO (rs8044769) and PGC1Α (rs8192678) polymorphisms in type 2 diabetic Turkish population
- Roles of OLR1 and IL17A variants on clinical phenotypes of Turkish patients undergoing coronary artery bypass surgery
- Cytokine gene polymorphism frequencies in Turkish population living in Marmara region
- Evaluation of BRCA1/2 gene mutations in patients with high-risk breast and/or ovarian cancer in Turkey
- Impacts of long noncoding RNA MALAT1 on LPS-induced periodontitis via modulating miR-155/SIRT1 axis
- Proteomics characterization of the adenovirus VA1 non-coding RNA on the landscape of cellular proteome
- Modulatory effect of pomegranate extract on TRPA1, TRPM2 and caspase-3 expressions in colorectal cancer induction of mice
- EpCAM is critical for tumor proliferation and oxaliplatin chemoresistance in EpCAMhigh/CD44+ colorectal cancer stem cells
- Prognostic factors in thrombotic thrombocytopenic purpura
- Possible effects of clinoptilolite on small intestinal ischemia-reperfusion injury caused by experimental mesenteric artery occlusion
- The relationship between pregnancies complicated with fetal growth restriction and umbilical cord blood endocan concentrations
- Sildenafil for the treatment of necrotizing enterocolitis: an experimental study
- The importance of LDH/Albumin, LDH/Lymphocyte, and LDH/Platelet ratios in the evaluation of COVID-19 B.1.1.7 variant
- The relationship between serum vitamin D and antibody response following two doses of inactivated COVID-19 vaccine
- The relationship between plasminogen activator inhibitor-1 levels and the course of disease in COVID-19 patients
- Could tear be an alternative specimen for SARS-CoV-2 detection?
- Case Report
- A case of falsely elevated D-dimer result