MAP3K1 SNP rs889312 potential risk and MAP3K9 SNP rs11628333 menopause dependent association for breast cancer

Introduction

Breast cancer is one of the widespread cancer worldwide, with an estimated 2.08 million cases diagnosed in 2018, accounting for 24.2% of all cancer cases. Breast cancer has been responsible for 15% of total cancer deaths, especially in less developed countries [1]. The incidence of breast cancer in Pakistan is 2.5 times more than in the neighboring countries [2]. Therefore, it is necessary to find the underlying causes of breast genetic cancer in the Pakistani population. Variations in a few important genes such as BRCA1 and BRCA2 are coupled with a high risk of breast cancer, but the majority of the breast cancer cases are related to the low penetrance genes that are often altered in the whole population.

Genetic studies have shown that breast cancer is a multifaceted and genomically complex disease. Deregulated signaling pathways e.g. competitive endogenous RNAs, non-coding RNAs, NEDD4 family of E3 Ubiquitin ligases and mTOR1 and mTOR2 play fundamental role in carcinogenesis and metastasis [3], [4], [5], [6].

Understanding the molecular basis of breast cancer can help early tumor detection and prevention [7]. One of the genetic causes of breast cancer is MAPK (mitogen-activated protein kinase) pathway. It consists of a family of protein-serine/threonine kinases, which are highly preserved in protein structures from unicellular eukaryotic organisms to multicellular organisms, including mammals [8]. The MAPK pathway is a vital bridge in the switch from extracellular signals to intracellular responses. The MAPK pathway controls various cell functions, including cell proliferation, differentiation, migration, apoptosis and responds to a diverse variety of signals inclusive of physiological origin for instance cytokines, growth factors and hormones, in addition to environmental signals and endogenous stress. Abnormalities in MAPK signaling influence most if not all these processes and play an important role in the progression and development of cancer. Classically, they are categorized as a mitogen and stress-activated MAPK, with ERK being the representative of mitogen, JNK and p38 of stress-responsive MAPKs [9], [10], [11]. These pathways are clinically important targets for cancer therapy by targeting; ERK pathway. Though, stress-induced MAPK pathways such as JNK play modulatory roles that can alter the feedback of cancer cells to both chemotherapies & targeted therapies [7]. MAPK pathway has a functionally essential role in many cancers including breast cancer and the role of MAPK pathway in breast cancer has been established therefore the purpose of the current study was to investigate the genetic predisposition of MAPKSNPs in breast cancer. We analyzed two hotspot SNPs of MAPK i.e. rs11628333 (MAP3K9, C>T) and rs889312 (MAP3K1, C>A) for their association analysis.

Materials and methods

The study was approved by the Ethical Review Committee, PMAS-Arid AAU, Rawalpindi, Pakistan. All the protocols, methods, and experiments used in the study were as per guidelines and approved by IBGE, Islamabad, Pakistan. The patients and controls were requested to participate in this study after informed consent.

Genotyping

Genotyping of the SNPs rs11628333 (MAP3K9, C>T) and rs889312 (MAP3K1, C>A) was performed by PCR-RFLP. Initially, amplification of the genetic region harboring the polymorphism for SNPs rs11628333 and rs889312 was done by PCR. Forward primer 5′GTGGGAGAAGGGGAAGAAAG′3 and reverse primer 5′TCCTGCATTCAAGCGATTCT′3 for rs11628333, forward primer 5′TGGCTTGTAGCTTTGTGGTG′3 and reverse primer 5′TTAGGCCTTCTTTGGCTTC′3 for rs889312 at a concentration of 1 mM was used for SNP specific PCR in a final volume of 25 µL containing 10 ηg of genomic DNA, 1X PCR buffer (NH₄)₂SO₄, 1 U Taq DNA polymerase, 1.5 µL of 1 mM MgCl₂, 0.5mM dNTPs and PCR water (Thermo Scientific, USA). PCR product was analyzed on 2% (w/v) agarose gel by electrophoresis.

RFLP of the PCR product of rs11628333 and rs889312 was done by incubation with restriction enzymes HpyF10VI and NlaIII (Thermo Fisher Scientific, USA) respectively at 37 °C for 16 h. The digested product was visualized on 2.5% (w/v) agarose gel by electrophoresis. The digested PCR products are shown in Figure 1. The gels were analyzed by gel documentation system (Syngene USA Inc.).

Figure 1:

Digested PCR products for the SNPs.

Results

Breast cancer patients (mean age 48.46 ± 15 years) along with gender-matched healthy individuals (mean age 46.23 ± 15.63) as control was analyzed. Breast cancer patients developed cancer before and after the onset of menopause. The majority of the patients were in stage II of breast cancer; 33.87% stage IV; 27.41% stage III and 3.22% stage I. As an anatomical categorization, the majority of the patients had invasive ductal carcinoma (85.18%) and lobular carcinoma (14.82%), while of these two categories one fourth (24.77%) patients suffered metastasis (Table 2). Furthermore, tumor was manifested in the upper outer quadrant of the mammary gland, while nipple-areola was the least affected.

Odds ratio

To define the strength of association, odds ratio (OR) with 95% Confidence interval (CI) for both SNPs was calculated (Table 2). The SNP rs889312 OR value was 0.55 (95% CI 0.31–0.96) for homozygous wild type AA, 1.30 (95% CI 0.74–2.26) inheterozygous AC and 7.06 (95% CI 1.23–40.34) observed in rare allele homozygous CC. The strength of association with an odds ratio for rare allele homozygous genotypes was statistically significant p-value 0.01 (p<0.05). However, the wild-type homozygous genotype OR value revealed a significant prevalence p-value 0.03 (p<0.05) in the control group. The heterozygous AC genotype behavior remained non-significant (Table 2). The forest plot for the OR results are shown in Figure 2(A).

Figure 2:

Forest plots for odds ratio values.

(A) Forest plot rs889312 (MAP3K1). (B) Forest plot rs11628333 (MAP3K9).

In the case of rs11628333 OR value for wild-type genotype TT was 0.70 (95% CI 0.39–1.24), rare allele CC homozygotes OR was 1.25 (95% CI 0.38–4.04), and for heterozygote TC the value was 1.37 (95% CI 0.76–2.47). The OR with 95% CI was non-significant p value >0.05. The forest plot for the OR results are shown in Figure 2(B).

Discussion

Breast cancer is among the life-threatening causes in developing countries. Compromised health care facilities and rapid urbanization in these countries, especially in the south and east Asia, there has been a rapid increase in the incidence of breast cancer.

A prompt and targeted strategy for assessing the likelihood of disease can help to lower the burden of breast cancer development. Therefore, the present study was designed in which only female patients with breast cancer having invasive or non-invasive breast cancer, along with lobular, ductal, or nipple-areola carcinoma, were selected for the study. Patients presenting with all stages of cancer, metastasis, and pre and post-menopause disease development were genetically screened.

MAPK pathway is multi-layered and composed of a three-tier kinase module in which a MAPK is activated by phosphorylation by MAPKK (mitogen-activated protein kinase), which consequently is activated upon phosphorylation by MAPKKK. MAP3K1-targeting therapeutic miRNA suppressed the invasion of breast cancer cells in experimental mice [12].

Depletion of MEKK1 inhibited the invasion and migratory ability of pancreatic cancer cells [13].

Tumor suppressor microRNAs have been shown to directly target MAP3K1 to inhibit the proliferation of non-small cell lung cancer cells [14].

Involvement of MAP3K1 and MAP3K9 genes SNP as candidate molecular marker for breast cancer association in Pakistani population was identified.

The involvement of MAP3K1 gene SNP rs889312 in association with breast cancer defined a mechanistic association with breast cancer in the Pakistani population. A strong association (p-value-0.01, <0.05) of the SNP has been observed with breast cancer, which was further evaluated for concrete evidence by OR 7.06 (1.23–40.34) at 95% CI.

The disease association strength for rs889312 has been well documented in East Asia, North Africa, and Northern Hemisphere populations (Table 4). These studies were conducted on breast cancer patients for the likelihood of SNPs associated with the disease development and or progression. Strong association of the SNP was observed in GWAS study conducted by Easton et al. 2007 [15] and the study included 3,882 breast cancer patients from the European network of excellence Cancer control using Population-based Registries and Biobank (CCPRB) [16]. A previous meta-analysis conducted to check the association of rs889312 with the hazard of breast cancer published that rs889312 was associated with a higher risk of breast cancer in small and large models of populations [17]. Another review indicated that rs889312 showed a relationship with the risk of breast cancer in Latin America [18]. In the Chilean population MAP3K1 rs889312 was associated with increased risk of familial breast cancer & in early-onset of non-familial breast cancer [19]. The present study of the Pakistani population representing the south Asian region also found a statistically significant association of rs889312 with breast cancer patients.

Contrastingly no statistically significant association of the MAP3K9 gene SNP rs11628333 (p-value 0.48), >0.05, OR 1.25 (0.38–4.04) at 95% CI was found for breast cancer. But it was surprising to find a higher frequency (9.57%) of risk allele homozygotes in breast cancer that developed breast cancer after the onset of menopause. However, the heterozygous TC was more prevalent (41.25%) in premenopausal breast cancer patients (Table 5).

The available literature on rs11628333 has been documented for its association with breast cancer at different levels of indigenous American ancestry by Slattery et al. 2015 [20]. The raw; adjusted p-value 0.018; 0.087 was reported. Our study also did not find statistically significant interaction of the SNP despite high-risk allele genotype frequency in patients compared to controls.

The higher frequency of rs889312 risk allele heterozygous AC and rs11628333 risk allele homozygous genotype in post-menopause patients (Table 5) can be considered as a prophylactic target with hormonal, lifestyle therapies.

MAP3K1 SNP rs889312 has been widely documented in strong association with breast cancer in different populations of the world (Table 6). The present study of the South Asian region Pakistan also strengthens previously reported scientific literature. But unlikely the association documented for MAP3K9 SNP rs11628333 with the risk of breast cancer [21], we have been unable to find a significant concrete association of the SNP with breast cancer etiology in the present study.

The present study presents MAP3K1 and MAP3K9 SNPs data for the first time from the south-east Asian region. Ethnicity, lifestyle, dietary habits, and environmental differences may provoke characteristic association of the SNPs with the risk of breast cancer which may not be significant in other parts or populations of the world. Secondly, in the present demographic data; there has been a family history of cancer.

Conclusions

In conclusion, the study summarizes a strong association of the MAP3K1 SNP rs889312 with the risk of breast cancer in this demographic region. Interestingly MAK3K9 SNP rs11628333 risk allele genotypes presented with the characteristic association of heterozygous genotype TC in pre-menopause breast cancer patients, while rare allele homozygous CC genotype was significantly prevalent in post-menopause patients. Thus rs889312 SNP can be regarded as a genetic marker for scaling the likely risk of breast cancer. And the female life hallmark menopause event may be regarded as provoking some epigenetic at its onset triggering the breast cancer as seen in the case with risk allele genotypes of rs11628333.