SLC22A2 – mapping genomic variations within South African indigenous and admixed populations
-
Brendon Pearce
Abstract
Background:
The SLC22A2 gene is a polyspecific transporter that mediates the electrogenic transport of small organic cations with different molecular structures. Furthermore, single-nucleotide polymorphisms (SNPs) of SLC22A2 are clinically significant because they can alter the transport of substrate drugs and may, thus, influence the efficacy and toxicity thereof. Additionally, further studies have reported that SLC22A2 is responsible for 80% of the total metformin clearance. Therefore, loss-of-function variants of SLC22A2 could affect the pharmacokinetic and pharmacodynamic characteristics of metformin. Although it is widely accepted that African populations harbor a greater amount of genomic diversity compared to other populations, limited information is available regarding genetic polymorphisms in SLC genes among African populations, specifically those related to impaired functional activity of hOCT2. Therefore, the aim of this study was to map known impaired function variants in the SLC22A2 gene.
Methods:
Development of multiplex SNaPshot™ genotyping assay for 20 previously reported SLC22A2 nonsynonymous SNPs and the assessment of baseline allele frequencies of these variants in 140 Cape Admixed, 148 Xhosa and 152 Zulu individuals residing in Cape Town, South Africa.
Results:
We identified three nonsynonymous SNPs, namely, A270S, R400C and K432Q in the population studied at minor allele frequencies of 6.1%, 3.4% and 0.7%, respectively. The most frequently observed haplotypes across all three populations were CATAATGCGTACGCGCGACG (~85%), CATAATGATTACGCGCGACG (~7%) and CATAATGAGTACGCGCGACG (~4.5%).
Conclusions:
In addition to SNPs, the haplotypes identified in this study can in future also aid in identifying associations between causative genetic variants and drug response. This study contributes in filling the gap that exists with regards to genetic information about important variations in organic cation transporter genes for the indigenous populations of South Africa.
Author contributions: All the authors have accepted responsibility for the entire content of this submitted manuscript and approved submission.
Research funding: None declared.
Employment or leadership: None declared.
Honorarium: None declared.
Competing interests: The funding organization(s) played no role in the study design; in the collection, analysis, and interpretation of data; in the writing of the report; or in the decision to submit the report for publication.
References
1. Choi MK, Song IS. Organic cation transporters and their pharmacokinetic and pharmacodynamic consequences. Drug Metab Pharmacokinet 2008;23:243–53.10.2133/dmpk.23.243Search in Google Scholar PubMed
2. Eichelbaum M, Ingelman-Sundberg M, Evans WE. Pharmacogenomics and individualized drug therapy. Annu Rev Med 2006;57:119–37.10.1146/annurev.med.56.082103.104724Search in Google Scholar PubMed
3. Tzvetkov MV, Vormfelde SV, Balen D, Meineke I, Schmidt T, Sehrt D, et al. The effects of genetic polymorphisms in the organic cation transporters OCT1, OCT2, and OCT3 on the renal clearance of metformin. Clin Pharmacol Ther 2009;86:299–306.10.1038/clpt.2009.92Search in Google Scholar PubMed
4. Evans WE, Relling MV. Moving towards individualized medicine with pharmacogenomics. Nature 2004;429:464–8.10.1038/nature02626Search in Google Scholar PubMed
5. Wang DS, Kusuhara H, Kato Y, Jonker JW, Schinkel AH, Sugiyama Y. Involvement of organic cation transporter 1 in the lactic acidosis caused by metformin. Mol Pharmacol 2003;63:844–8.10.1124/mol.63.4.844Search in Google Scholar PubMed
6. Hayer-Zillgen M, Bruss M, Bonisch H. Expression and pharmacological profile of the human organic cation transporters hOCT1, hOCT2 and hOCT3. Br J Pharmacol 2002;136:829–36.10.1038/sj.bjp.0704785Search in Google Scholar PubMed PubMed Central
7. Emami Riedmaier A, Fisel P, Nies AT, Schaeffeler E, Schwab M. Metformin and cancer: from the old medicine cabinet to pharmacological pitfalls and prospects. Trends Pharmacol Sci 2013;34:126–35.10.1016/j.tips.2012.11.005Search in Google Scholar PubMed
8. Kimura N, Okuda M, Inui K. Metformin transport by renal basolateral organic cation transporter hOCT2. Pharm Res 2005;22:255–9.10.1007/s11095-004-1193-3Search in Google Scholar PubMed
9. Zhang L, Dresser MJ, Gray AT, Yost SC, Terashita S, Giacomini KM. Cloning and functional expression of a human liver organic cation transporter. Mol Pharmacol 1997;51:913–21.10.1124/mol.51.6.913Search in Google Scholar PubMed
10. Hardy BJ, Seguin B, Goodsaid F, Jimenez-Sanchez G, Singer PA, Daar AS. The next steps for genomic medicine: challenges and opportunities for the developing world. Nat Rev Genet 2008;9(Suppl 1):S23–7.10.1038/nrg2444Search in Google Scholar PubMed
11. Gorboulev V, Ulzheimer JC, Akhoundova A, Ulzheimer-Teuber I, Karbach U, Quester S, et al. Cloning and characterization of two human polyspecific organic cation transporters. DNA Cell Biol 1997;16:871–81.10.1089/dna.1997.16.871Search in Google Scholar PubMed
12. Via M, Ziv E, Burchard EG. Recent advances of genetic ancestry testing in biomedical research and direct to consumer testing. Clin Genet 2009;76:225–35.10.1111/j.1399-0004.2009.01263.xSearch in Google Scholar PubMed PubMed Central
13. Abrahams Z, D’Amato ME, Davison S, Benjeddou M. Allele frequencies of six non-CODIS miniSTR loci (D1S1627, D3S4529, D5S2500, D6S1017, D8S1115 and D9S2157) in three South African populations. Forensic Sci Int Genet 2011;5:354–5.10.1016/j.fsigen.2010.01.019Search in Google Scholar PubMed
14. Berniell-Lee G, Calafell F, Bosch E, Heyer E, Sica L, Mouguiama-Daouda P, et al. Genetic and demographic implications of the Bantu expansion: insights from human paternal lineages. Mol Biol Evol 2009;26:1581–9.10.1093/molbev/msp069Search in Google Scholar PubMed
15. Lane A, Soodyall H, Arndt S, Ratshikhopha M, Jonker E, Freeman C, et al. Genetic substructure in South African Bantu-speakers: evidence from autosomal DNA and Y-chromosome studies. Am J Phys Anthropol 2002;119:175–85.10.1002/ajpa.10097Search in Google Scholar PubMed
16. Tishkoff SA, Reed FA, Friedlaender FR, Ehret C, Ranciaro A, Froment A, et al. The genetic structure and history of Africans and African Americans. Science 2009;324:1035–44.10.1126/science.1172257Search in Google Scholar PubMed PubMed Central
17. Hardy B-J, Séguin B, Ramesar R, Singer PA, Daar AS. South Africa: from species cradle to genomic applications. Nat Rev Genet 2008;9:S19–23.10.1038/nrg2441Search in Google Scholar PubMed
18. Drögemöller BI, Wright GE, Niehaus DJ, Koen L, Malan S, Da Silva DM, et al. Characterization of the genetic profile of CYP2C19 in two South African populations. Pharmacogenomics 2010;11:1095–103.10.2217/pgs.10.90Search in Google Scholar PubMed
19. Warnich L, Drögemöller BI, Pepper MS, Dandara C, Wright GE. Pharmacogenomic research in South Africa: lessons learned and future opportunities in the rainbow nation. Curr Pharmacogenomics Person Med 2011;9:191–207.10.2174/187569211796957575Search in Google Scholar PubMed PubMed Central
20. Takeuchi A, Motohashi H, Okuda M, Inui K. Decreased function of genetic variants, Pro283Leu and Arg287Gly, in human organic cation transporter hOCT1. Drug Metab Pharmacokinet 2003;18:409–12.10.2133/dmpk.18.409Search in Google Scholar PubMed
21. Flicek P, Amode MR, Barrell D, Beal K, Brent S, Carvalho-Silva D, et al. Ensembl 2012. Nucleic Acids Res 2012;40(Database issue):D84–90.10.1093/nar/gkr991Search in Google Scholar PubMed PubMed Central
22. Flanagan SE, Patch A-M, Ellard S. Using SIFT and PolyPhen to predict loss-of-function and gain-of-function mutations. Genet Test Mol Biomarkers 2010;14:533–7.10.1089/gtmb.2010.0036Search in Google Scholar PubMed
23. Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc 2009;4:1073–81.10.1038/nprot.2009.86Search in Google Scholar PubMed
24. Ng PC, Henikoff S. SIFT: predicting amino acid changes that affect protein function. Nucleic Acids Res 2003;31:3812–4.10.1093/nar/gkg509Search in Google Scholar PubMed PubMed Central
25. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 2000;132:365–86.10.1385/1-59259-192-2:365Search in Google Scholar
26. Shi YY, He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res 2005;15:97–8.10.1038/sj.cr.7310101Search in Google Scholar
27. Li Z, Zhang Z, He Z, Tang W, Li T, Zeng Z, et al. A partition-ligation-combination-subdivision EM algorithm for haplotype inference with multiallelic markers: update of the SHEsis (http://analysis.bio-x.cn). Cell Res 2009;19:519–23.10.1038/cr.2009.33Search in Google Scholar PubMed
28. Leabman MK, Huang CC, DeYoung J, Carlson EJ, Taylor TR, de la Cruz M, et al. Natural variation in human membrane transporter genes reveals evolutionary and functional constraints. Proc Natl Acad Sci USA 2003;100:5896–901.10.1073/pnas.0730857100Search in Google Scholar PubMed PubMed Central
29. Ma Q, Lu AY. Pharmacogenetics, pharmacogenomics, and individualized medicine. Pharmacol Rev 2011;63:437–59.10.1124/pr.110.003533Search in Google Scholar PubMed
30. Leabman MK, Huang CC, Kawamoto M, Johns SJ, Stryke D, Ferrin TE, et al. Polymorphisms in a human kidney xenobiotic transporter, OCT2, exhibit altered function. Pharmacogenetics 2002;12:395–405.10.1097/00008571-200207000-00007Search in Google Scholar PubMed
31. Chen Y, Li S, Brown C, Cheatham S, Castro RA, Leabman MK, et al. Effect of genetic variation in the organic cation transporter 2, OCT2, on the renal elimination of metformin. Pharmacogenet Genomics 2009;19:497–504.10.1097/FPC.0b013e32832cc7e9Search in Google Scholar PubMed PubMed Central
32. Kroetz DL, Yee SW, Giacomini KM. The pharmacogenomics of membrane transporters project: research at the interface of genomics and transporter pharmacology. Clin Pharmacol Ther 2010;87:109–16.10.1038/clpt.2009.226Search in Google Scholar PubMed PubMed Central
33. Kang HJ, Song IS, Shin HJ, Kim WY, Lee CH, Shim JC, et al. Identification and functional characterization of genetic variants of human organic cation transporters in a Korean population. Drug Metab Dispos 2007;35:667–75.10.1124/dmd.106.013581Search in Google Scholar PubMed
34. Choi CI, Lee YJ, Lee HI, Kim BH, Kim MJ, Jang CG, et al. Effects of the SLCO1B1*15 allele on the pharmacokinetics of pitavastatin. Xenobiotica 2012;42:496–501.10.3109/00498254.2011.632030Search in Google Scholar PubMed
35. Song IS, Shin HJ, Shin JG. Genetic variants of organic cation transporter 2 (OCT2) significantly reduce metformin uptake in oocytes. Xenobiotica 2008;38:1252–62.10.1080/00498250802130039Search in Google Scholar PubMed
36. Wang ZJ, Yin OQ, Tomlinson B, Chow MS. OCT2 polymorphisms and in-vivo renal functional consequence: studies with metformin and cimetidine. Pharmacogenet Genomics 2008;18:637–45.10.1097/FPC.0b013e328302cd41Search in Google Scholar PubMed
37. Li Q, Liu F, Zheng TS, Tang JL, Lu HJ, Jia WP. SLC22A2 gene 808 G/T variant is related to plasma lactate concentration in Chinese type 2 diabetics treated with metformin. Acta Pharmacol Sin 2010;31:184–90.10.1038/aps.2009.189Search in Google Scholar PubMed PubMed Central
©2016 Walter de Gruyter GmbH, Berlin/Boston
Articles in the same Issue
- Frontmatter
- Editorial
- The Santorini Conferences continue
- Mini Reviews
- CYP2D6 variability in populations from Venezuela
- Can pharmacogenetics help patients under chronic treatment with coumarin anticoagulants?
- Pharmacogenetic studies: a tool to improve antidepressant therapy
- Original Articles
- 1846G>A polymorphism of CYP2D6 gene and extrapyramidal side effects during antipsychotic therapy among Russians and Tatars: a pilot study
- SLC22A2 – mapping genomic variations within South African indigenous and admixed populations
- Improvement of the chemical inhibition phenotyping assay by cross-reactivity correction
- Enhanced oral bioavailability of metoprolol with gallic acid and ellagic acid in male Wistar rats: involvement of CYP2D6 inhibition
- Case Report
- Vancomycin-induced thrombocytopenia in a newborn
- Acknowledgment
- Acknowledgment
- Congress Abstracts
- 8th Santorini Conference Systems Medicine and Personalised Health and Therapy
Articles in the same Issue
- Frontmatter
- Editorial
- The Santorini Conferences continue
- Mini Reviews
- CYP2D6 variability in populations from Venezuela
- Can pharmacogenetics help patients under chronic treatment with coumarin anticoagulants?
- Pharmacogenetic studies: a tool to improve antidepressant therapy
- Original Articles
- 1846G>A polymorphism of CYP2D6 gene and extrapyramidal side effects during antipsychotic therapy among Russians and Tatars: a pilot study
- SLC22A2 – mapping genomic variations within South African indigenous and admixed populations
- Improvement of the chemical inhibition phenotyping assay by cross-reactivity correction
- Enhanced oral bioavailability of metoprolol with gallic acid and ellagic acid in male Wistar rats: involvement of CYP2D6 inhibition
- Case Report
- Vancomycin-induced thrombocytopenia in a newborn
- Acknowledgment
- Acknowledgment
- Congress Abstracts
- 8th Santorini Conference Systems Medicine and Personalised Health and Therapy
