Study on the association of LINC00924 with prognosis and malignant progression of thyroid cancer
-
Luwei Niu
,
Qing Lu
,
Ran Li
and
Jiaxin Zhang
Abstract
Objectives
This study aimed to investigate the role of LINC00924 and its prognostic value in thyroid cancer (TC).
Methods
The study included cancer tissues from 101 TC patients and four TC cell lines. LINC00924 and miR-454-3p levels were measured using qRT-PCR. Patients were categorized into two groups according to LINC00924 levels. Cox regression analysis and Kaplan–Meier survival analysis were conducted to assess the correlation of LINC00924 with the pathological features of TC patients and its prognostic value. Additionally, validation of LINC00924 and miR-454-3p targeting relationship using dual luciferase reporter assay, and CCK-8 and Transwell assays were performed to evaluate TC cell proliferation, migration, and invasion.
Results
LINC00924 downregulated in TC tissues and cell lines, while miR-454-3p exhibited a marked upregulation. Lower LINC00924 expression correlated with advanced TNM stage, lymph node metastasis, and poorer overall survival. Cox analysis Kaplan-Meier survival analysis identified LINC00924 as an independent prognostic factor. Mechanistically, LINC00924 directly bound and negatively regulated miR-454-3p, acting as a molecular sponge. Functional experiments showed that LINC00924 suppressed TC cell proliferation, migration, and invasion, effects that were partially reversed by miR-454-3p.
Conclusions
LINC00924 may affect TC cell activity by regulating miR-454-3p. Furthermore, LINC00924 had potential as a clinical prognostic marker for TC.
Introduction
Thyroid cancer (TC) is a malignant tumor of the thyroid and is the most common endocrine system tumor [1]. and its incidence is on the rise, especially among women [2]. With ongoing advances in diagnostic methods, treatment options, and patient management, the care of TC patients has significantly improved [3]. Early-stage differentiated TC generally has a good prognosis, with a 5-year relative survival rate as high as 98.5 % [4]. Despite the favorable prognosis for most thyroid cancer patients, some still exhibit aggressive growth and poorer survival rates [5]. Additionally, the incidence of advanced TC has increased, leading to worse prognoses [6]. Thus, discovering novel biomarkers for predicting the prognosis and understanding the malignant progression of thyroid cancer holds great clinical significance.
Over the past 30 years, with rapid advancements in molecular genetics and genomics, the diagnosis, prognostic markers, and therapeutic agents for TC have entered a new era [7]. Long non-coding RNAs (lncRNAs) are commonly abnormally expressed in cancers and can impact disease development by participating in various biochemical and cellular activities [8], 9]. Abnormal expression of lncRNAs has also been observed in TC, where they exert tumor-suppressive or oncogenic effects by mediating genetic drivers in TC cells [10]. For instance, DARS-AS1 influences the growth of thyroid cancer cells and plays a role in the malignant progression of the disease [11]. Currently, research on LINC00924 is limited, but it is noteworthy that Wang et al. found through prognostic modeling analysis and in vitro experiments that LINC00924 is involved in the pathological process of papillary thyroid carcinoma (PTC) [12]. Furthermore, other studies have used bioinformatics methods to find that LINC00924 is associated with prognosis in TC patients [13]. Therefore, we hypothesize that LINC00924 may be associated with the prognosis and malignant progression of TC, and may be involved in the pathological mechanisms of TC at the molecular level.
To verify this hypothesis, this research compared LINC00924 levels in various thyroid tissues and cell lines, used Kaplan–Meier survival analysis to assess its impact on patient prognosis, and employed Cox regression to evaluate its correlation with clinical pathology in TC. Additionally, the roles of LINC00924 in promoting TC cell proliferation, migration, and invasion were also explored, aiming to provide new perspectives and evidence for TC therapy and prognosis and to fill the knowledge gap in studies related to the malignant progression of TC.
Materials and methods
Patient inclusion and follow-up investigation
101 patients with TC who were treated at The Affiliated Hospital of Xuzhou Medical University were enrolled. The study protocol was approved by The Ethics Committee of The Affiliated Hospital of Xuzhou Medical University (No. XYFY2024-KL442-01) and followed the principles outlined in the Declaration of Helsinki. Each patient was over 18 years of age and gave informed consent. None of the patients had received chemotherapy or radiotherapy before surgery. Paired cancerous and adjacent normal tissues were isolated and confirmed by pathologists. The obtained tissues were stored at −80 °C for subsequent analysis. Patients were followed up for five years post-surgery to monitor their postoperative conditions.
The sample size was calculated using G*Power software (http://www.gpower.hhu.de/) and appropriately adjusted based on previous research by Yu et al. [14]. At a 5 % significance level, 101 participants are sufficient to provide 80 % power to detect differences in LINC00924 and miR-454-3p.
Cell lines and transfection
Thyroid cancer cell lines TPC-1 (cat. no. FH1039, Shanghai Fuheng Biotechnology Co.), 8505C (cat. no. ZQ0305, Zhong Qiao Xin Zhou Biotechnology Co.), BCPAP (cat. no. ZQ0304, Zhong Qiao Xin Zhou Biotechnology Co.), and C643 (cat. no. FH1087, Shanghai Fuheng Biotechnology Co.), as well as normal thyroid cells Nthy-ori 3-1 (cat. no. ZQ0874, Zhong Qiao Xin Zhou Biotechnology Co.) were cultured in DMEM or RPMI Medium 1,640 supplemented with 10 % FBS. The incubator conditions were set to 37 °C and 5 % CO2 [15].
We prioritized the two cell lines with the most significant expression differences, BCPAP and C643 cells were seeded in 6-well plates. oe-LINC, oe-NC, miR mimic, and miR-NC were transfected into it by Lipofectamine 2000 [16]. After 48 h, subsequent experiments were conducted. Control group cells were left untreated.
qRT-PCR
Total RNA was extracted from patient tissues and stably transfected cells with Trizol (Invitrogen, CA, USA). The RNA was reverse transcribed into cDNA using the ReverTra Ace quantitative polymerase chain reaction (qPCR) reverse transcription kit (Toyobo Life Science, Shanghai, China). LINC00924 and miR-454-3p levels were measured using Bio-Rad S1000 with Bestar SYBR Green RT-PCR Master Mix (Toyobo Life Science, Shanghai, China). Based on previous similar studies, GAPDH was selected as an internal reference for LINC00924, and U6 was selected as an internal reference for miR-454-3p [17]. Thermocycling conditions were 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min [18]. The special primer sequences (5ʹ-3ʹ) were as follows: LINC00924, forward: CCAGTATGCCAAGTGAACACA and reverse: ATGCACAGTGCTGAGTTGTTT; miR-454-3p, forward: GCGCGTAGTGCAATATTGCTTA and reverse: AGTGCAGGGTCCGAGGTATT.
Cell counting kit-8(CCK-8) assay
Cell proliferation was assessed using CCK-8 colorimetry (Beyotime, Jiangsu, China). Briefly, after 48 h of transfection, BCPAP, and C643 cells were seeded into 96-well plates at a density of 5 × 103 cells per well. The cells were then cultured for 0, 24, 48, and 72 h. At each time point, 10 µL of CCK-8 reagent was added to each well, followed by an additional 4 h of incubation. The optical density (OD) was then measured at 450 nm using a microplate reader [19].
Transwell assay
Migration and invasion of BCPAP and C643 cells were evaluated using Transwell assays. The experiment utilized 24-well Transwell cell culture chambers (Corning, NY, USA). For the invasion assay, Matrigel was coated on the upper chamber of the Transwell, while no coating was applied for the migration assay. The subsequent procedures were similar: BCPAP and C643 cells were resuspended in a serum-free medium and seeded into the upper chamber, with a medium containing 10 % FBS added to the lower chamber. After incubation at 37 °C for 24 h, cells that migrated or invaded through the membrane were fixed with a cotton swab, stained with crystal violet, and then counted under a microscope [20].
Target prediction and dual-luciferase reporter assay
The target of LINC00924 was predicted using the lncRNASNP online database and found miR-454-3p. A sequence fragment containing potential binding sites was cloned into a luciferase reporter vector, and WT-LINC00924 and MT-LINC00924 were constructed. The vector was co-transfected with miR-454-3p mimic or inhibitor into BCPAP and C643 cells. The luciferase activity of LINC00924 was detected using a dual-luciferase reporter assay kit and normalized to Renilla [21].
Statistical analysis
All data were expressed as mean ± SD. Data analysis and graphing were performed using SPSS 22.0 and GraphPad Prism 8.0. Differences between two groups were analyzed using the Student’s t-test. One-way ANOVA was used for multiple groups. Survival analysis of included patients was examined by Kaplan–Meier curves. Independent prognostic factors were assessed using Cox regression analysis. p<0.05 was considered statistically significant.
Changes in LINC00924 and miR-454-3p levels in TC tissues and TC cell lines. A and B. LINC00924 expression is decreased in TC patient tissues, and miR-454-3p is increased (****p<0.0001). C and D. Compared to normal thyroid cells, LINC00924 expression is decreased and miR-454-3p is increased in TC cells (****p<0.0001).
Results
Changes in LINC00924 and miR-454-3p Levels in Patient Tissues and TC Cells
LINC00924 and miR-454-3p levels were assessed in TC tissues. It was found that LINC00924 was substantially downregulated in TC tissues, while miR-454-3p displayed a marked upregulation (p<0.0001, Figure 1A and B). The study also assessed the expression levels of LINC00924 and miR-454-3p in Nthy-ori 3-1 normal thyroid cells and various thyroid cancer cell lines, including TPC-1, 8505C, BCPAP, and C643. The findings revealed that LINC00924 was significantly decreased in the cancer cell lines, whereas miR-454-3p was markedly increased (p<0.0001, Figure 1C and D).
Correlation between LINC00924 and clinical features and prognosis of TC
Our research initially divided patients into a low LINC00924 group (52 cases) and a high LINC00924 group (49 cases) based on LINC00924 levels in TC tissues. As shown in Table 1, there are no significant differences in age, gender, and tumor size between the two patient groups (p>0.05). However, there are significant differences in TNM stage, lymph node metastasis, and distant metastasis (p<0.05). Furthermore, Cox analysis identified that LINC00924 levels (p=0.015), TNM stage (p=0.030), and lymph node metastasis (p=0.036) are independent prognostic risk factors for patients with TC (Table 2). Additionally, Kaplan-Meier survival analysis of the follow-up data revealed that the overall survival rate in the high LINC00924 expression group was significantly higher than that in the low expression group (Figure 2).
Clinical baseline characteristics of participants.
| Features | Low LINC00924 (n=52) | High LINC00924 (n=49) | p-Value |
|---|---|---|---|
| Age (years) | 0.198 | ||
| <50 | 23 | 28 | |
| ≥50 | 29 | 21 | |
| Gender | 0.367 | ||
| Female | 27 | 21 | |
| Male | 25 | 28 | |
| Tumor size, mm | 0.403 | ||
| ≤3 | 16 | 19 | |
| >30 | 36 | 30 | |
| TNM stage | 0.021 | ||
| I–II | 13 | 23 | |
| III | 39 | 26 | |
| Lymph node metastasis | 0.034 | ||
| Yes | 30 | 38 | |
| No | 22 | 11 | |
| Distance metastasis | 0.034 | ||
| Yes | 30 | 38 | |
| No | 22 | 11 |
Multivariate Cox analysis of LINC00924 and clinical parameters with overall survival.
| Items | p-Value | Multivariate analysis HR | 95 % CI |
|---|---|---|---|
| LINC00924 | 0.015 | 0.341 | 0.143–0.814 |
| Age | 0.240 | 0.619 | 0.278–1.378 |
| Gender | 0.452 | 1.353 | 0.615–2.977 |
| Size | 0.164 | 1.774 | 0.791–3.976 |
| TNM stage | 0.030 | 2.356 | 1.089–5.097 |
| Lymph node metastasis | 0.036 | 2.327 | 1.056–5.131 |
| Distance metastasis | 0.433 | 1.363 | 0.629–2.955 |
-
p<0.05 represents a statistically significant difference. The bold values are used to highlight items with p<0.05.
Kaplan–Meier analysis of LINC00924 in TC patients (log-rank p=0.042).
LINC00924 targeted miR-454-3p
lncRNASNP online database predicted that miR-454-3p was a target of LINC00924 and identified their binding sites (Figure 3A). The binding relationship between LINC00924 and miR-454-3p was validated through dual-luciferase reporter assays in BCPAP and C643 cell lines. miR-454-3p mimic statistically inhibited the luciferase activity of LINC00924, whereas miR-454-3p inhibitor significantly enhanced LINC00924’s luciferase activity (p<0.0001, Figure 3B and C). Furthermore, the levels of LINC00924 and miR-454-3p exhibited a clear inverse correlation in tumor tissues obtained from thyroid cancer patients (r=−6,759, p<0.0001, Figure 3D).
LINC00924 targets miR-454-3p. A. Binding sites of LINC00924 and miR-454-3p. B and C. Dual-luciferase reporter assays (****p<0.0001). D. Correlation between LINC00924 and miR-454-3p in TC (r=−0.6759, p<0.0001).
LINC00924/miR-454-3p axis regulates TC cell proliferation, migration, and invasion
We performed gain-of-function experiments in BCPAP and C643 cells using oe-LINC00924 and miR-454-3p mimics to further explore the function of the LINC00924/miR-454-3p axis in TC cells. After transfection with oe-LINC00924, the levels of LINC00924 were markedly increased, while the expression of miR-454-3p was significantly reduced. Conversely, transfection with the miR-454-3p mimic led to a substantial elevation in miR-454-3p levels (p<0.0001, Figure 4A–D). Meanwhile, elevated LINC00924 inhibited the proliferation of BCPAP and C643 cells, while increased expression of miR-454-3p promoted proliferation (p<0.001, Figure 4E and F). Moreover, overexpression of LINC00924 also suppressed the migration and invasion of BCPAP and C643, whereas overexpression of miR-454-3p reversed them (p<0.001, Figure 4G and H).
Influence of LINC00924/miR-454-3p on TC cell. The impact of transfecting oe-LINC00924 and miR-454-3p mimic on LINC00924 (A and B), miR-454-3p (C and D), cell proliferation (E and F), migration (G), and invasion (H) in TC cells. ***p<0.001, ****p<0.0001.
Discussion
Almost all cell types in the thyroid can lead to TC [22], which typically presents as painless masses or nodules [23]. Recent reports indicate a rising incidence of TC among adolescents and young adults [24]. However, while fine needle aspiration biopsy is considered the gold standard for evaluating suspicious nodules, it lacks sufficient accuracy for definitive cancer diagnosis [25]. The TNM classification system for prognostic categorization in TC patients also requires further refinement [26]. Therefore, recognizing or discovering more novel prognostic markers and therapeutic targets for TC patients is crucial for improving clinical management and outcomes.
Recent studies suggest that abnormal expression of lncRNAs can affect cancer cell growth and migration, potentially playing functional roles [27], 28]. Furthermore, the levels of lncRNAs in tumors are tissue-specific, giving them the potential to serve as biomarkers for predicting tumor development [29]. A single lncRNA may be associated with the onset and progression of multiple tumors; for instance, lncRNA RMRP is associated with bladder cancer, gastric cancer, and non-small cell lung cancer [30], [31], [32], showing its important clinical significance. Several lncRNAs related to TC have already been identified, such as lncRNA LINC00460, which is involved in the activity of PTC cells [33]. Researchers have discovered a correlation between LINC00924 and peritoneal metastasis in gastric cancer, indicating that it could serve as a prognostic biomarker for this cancer type [34], 35]. There are also reports indicating that LINC00924 is involved in liver cancer and lung adenocarcinoma [36], 37]. However, reports on the role of LINC00924 in other malignancies are scarce. In our research, LINC00924 was markedly decreased in tissues from thyroid cancer patients and various TC cell lines, and its reduced expression may be associated with poorer prognosis and tumor progression. Our study revealed a significant correlation between LINC00924 expression levels and key clinicopathological features of TC, including TNM staging and lymph node metastasis, and low LINC00924 levels were associated with lower survival rates in TC patients, which corresponds with previous findings that downregulated LINC00924 was associated with longer disease-free survival in TC patients [13]. Additionally, functional analyses indicated that the overexpression of LINC00924 reduced the proliferation, migration, and invasion of TC cells. These results highlighted that LINC00924 acts as a tumor suppressor in TC and could serve as a potential prognostic marker for the disease.
Additionally, the downstream targets of LINC00924 were examined, revealing that LINC00924 directly interacts with miR-454-3p and suppresses its expression through a negative regulatory mechanism. Notably, studies of miR-454-3p could inhibit the influence of LINC00924 on TC cells. Several reports have shown that miR-454-3p mediates the features of various lncRNAs. For instance, The overexpression of miR-454-3p reduced the inhibitory effect of LINC00887 on the invasion of cervical cancer cells. [38]. More importantly, miR-454-3p influenced the effect of lncRNA H19 on the activity of anaplastic thyroid cancer (ATC) cells. [39]. These findings suggest that miR-454-3p functions as a critical downstream effector and potential mediator of lncRNA activity in thyroid and other cancers. Consequently, it is hypothesized that the suppressive effect of LINC00924 on TC cells might be mediated by acting as a molecular sponge for miR-454-3p. This sponging mechanism could serve as a key regulatory axis in TC progression, offering promising targets for therapeutic intervention.
In summary, LINC00924 is markedly downregulated in TC and holds promise as a prognostic indicator. Its capacity to suppress tumor cell proliferation, migration, and invasion via negatively regulating miR-454-3p underscores the importance of the LINC00924/miR-454-3p axis in TC pathogenesis. These findings not only advance our understanding of the molecular mechanisms underlying TC progression but also provide valuable directions for developing novel prognostic tools and targeted therapies to improve patient outcomes.
Acknowledgments
Study on the correlation of LINC00924 with prognosis and malignant progression of thyroid cancer.
-
Research ethics: The study protocol was approved by The Ethics Committee of The Affiliated Hospital of Xuzhou Medical University (No. XYFY2024-KL442-01) and followed the principles outlined in the Declaration of Helsinki.
-
Informed consent: In addition, informed consent has been obtained from the participants involved.
-
Author contributions: L W N and Q L conceived and designed the experiments. R L and J X Z performed the experiments. L W N and Q L contributed sample collection and statistical analysis. R L and J X Z wrote the manuscript. All authors revised it critically for important intellectual content. All authors read and approved the final manuscript.
-
Use of Large Language Models, AI and Machine Learning Tools: None declared.
-
Conflict of interest: The authors state no conflict of interest.
-
Research funding: No funding was received to assist with the preparation of this work.
-
Data availability: Data can be shared upon reasonable request by the corresponding author.
References
1. Guenter, R, Patel, Z, Chen, H. Notch signaling in thyroid cancer. Adv Exp Med Biol 2021;1287:155–68. https://doi.org/10.1007/978-3-030-55031-8_10.Search in Google Scholar PubMed PubMed Central
2. Kaliszewski, K, Wojtczak, B, Sutkowski, K, Rudnicki, J. Thyroid cancer surgery – in what direction are we going? A mini-review. J Int Med Res 2020;48:300060520914803. https://doi.org/10.1177/0300060520914803. .Search in Google Scholar PubMed PubMed Central
3. Chen, DW, Lang, BHH, McLeod, DSA, Newbold, K, Haymart, MR. Thyroid cancer. Lancet 2023;401:1531–44. https://doi.org/10.1016/s0140-6736(23)00020-x.Search in Google Scholar
4. Boucai, L, Zafereo, M, Cabanillas, ME. Thyroid cancer: a review. JAMA 2024;331:425–35. https://doi.org/10.1001/jama.2023.26348.Search in Google Scholar PubMed
5. Janz, TA, Neskey, DM, Nguyen, SA, Lentsch, EJ. Is the incidence of anaplastic thyroid cancer increasing: a population based epidemiology study. World J Otorhinolaryngol Head Neck Surg 2019;5:34–40. https://doi.org/10.1016/j.wjorl.2018.05.006.Search in Google Scholar PubMed PubMed Central
6. Agosto Salgado, S, Kaye, ER, Sargi, Z, Chung, CH, Papaleontiou, M. Management of advanced thyroid cancer: overview, advances, and opportunities. Am Soc Clin Oncol Educ Book 2023;43:e389708. https://doi.org/10.1200/edbk_389708.Search in Google Scholar PubMed
7. Alzahrani, AS. Clinical use of molecular data in thyroid nodules and cancer. J Clin Endocrinol Metab 2023;108:2759–71. https://doi.org/10.1210/clinem/dgad282.Search in Google Scholar PubMed
8. Li, Z, Wang, D, Zhu, X. Unveiling the functions of five recently characterized lncRNAs in cancer progression. Clin Transl Oncol 2024;27:458–65. https://doi.org/10.1007/s12094-024-03619-w.Search in Google Scholar PubMed
9. Mei, Y, Khan, H, Shishikura, M, Ishiyama, S, Khan, A, Orita, H, et al.. pfeRNAs-A novel class of small non-coding RNAs with real translational potential. J Surg Res 2023;284:237–44. https://doi.org/10.1016/j.jss.2022.12.002.Search in Google Scholar PubMed PubMed Central
10. Sedaghati, M, Kebebew, E. Long noncoding RNAs in thyroid cancer. Curr Opin Endocrinol Diabetes Obes 2019;26:275–81. https://doi.org/10.1097/med.0000000000000497.Search in Google Scholar
11. Zheng, W, Tian, X, Cai, L, Shen, YM, Cao, QS, Yang, JY, et al.. LncRNA DARS-AS1 regulates microRNA-129 to promote malignant progression of thyroid cancer. Eur Rev Med Pharmacol Sci 2019;23:10443–52. https://doi.org/10.26355/eurrev_201912_19683.Search in Google Scholar PubMed
12. Wang, Y, Li, X, Huang, Y, Gang, Q, Liu, M, Zhang, H, et al.. The prognostic value and potential immune mechanisms of lncRNAs related to immunogenic cell death in papillary thyroid carcinoma. J Inflamm Res 2024;17:1995–2008. https://doi.org/10.2147/jir.s456452.Search in Google Scholar PubMed PubMed Central
13. Rao, Y, Liu, H, Yan, X, Wang, J. In silico analysis identifies differently expressed lncRNAs as novel biomarkers for the prognosis of thyroid cancer. Comput Math Methods Med 2020;2020:3651051. https://doi.org/10.1155/2020/3651051.Search in Google Scholar PubMed PubMed Central
14. Yu, Q, Sun, W, Hua, H, Chi, Y, Liu, X, Dong, A, et al.. Downregulation of miR-140 is correlated with poor prognosis and progression of thyroid cancer. Endocr, Metab Immune Disord: Drug Targets 2021;21:749–55. https://doi.org/10.2174/1871530320666200724180742.Search in Google Scholar PubMed
15. Wang, G, Le, Y, Wei, L, Cheng, L. CREB3 transactivates lncRNA ZFAS1 to promote papillary thyroid carcinoma metastasis by modulating miR-373-3p/MMP3 regulatory Axis. Internet J Endocrinol 2021;2021:9981683. https://doi.org/10.1155/2021/9981683.Search in Google Scholar PubMed PubMed Central
16. Ye, Y, Song, Y, Zhuang, J, He, S, Ni, J, Xia, W. Long noncoding RNA CCAL promotes papillary thyroid cancer progression by activation of NOTCH1 pathway. Oncol Res 2018;26:1383–90. https://doi.org/10.3727/096504018x15188340975709.Search in Google Scholar PubMed PubMed Central
17. Xiao, S, Zuo, Y, Li, Y, Huang, Y, Fu, S, Yuan, D, et al.. Long noncoding RNA HAGLROS promotes the malignant progression of bladder cancer by regulating the miR-330-5p/SPRR1B Axis. Front Oncol 2022;12:876090. https://doi.org/10.3389/fonc.2022.876090.Search in Google Scholar PubMed PubMed Central
18. Tian, F, Ying, H, Liao, S, Wang, Y, Wang, Q. lncRNA SNHG14 promotes the proliferation, migration, and invasion of thyroid tumour cells by regulating miR-93-5p. Zygote 2022;30:183–93. https://doi.org/10.1017/s0967199421000319.Search in Google Scholar PubMed
19. Jiang, L, Zhang, Y, Su, P, Ma, Z, Ye, X, Kang, W, et al.. Long non-coding RNA HNF1A-AS1 induces 5-FU resistance of gastric cancer through miR-30b-5p/EIF5A2 pathway. Transl Oncol 2022;18:101351. https://doi.org/10.1016/j.tranon.2022.101351.Search in Google Scholar PubMed PubMed Central
20. Liu, C, Qiu, H, Lin, D, Wang, Z, Shi, N, Tan, Z, et al.. c-Jun-dependent beta3GnT8 promotes tumorigenesis and metastasis of hepatocellular carcinoma by inducing CD147 glycosylation and altering N-glycan patterns. Oncotarget 2018;9:18327–40. https://doi.org/10.18632/oncotarget.24192.Search in Google Scholar PubMed PubMed Central
21. Tan, T, Tu, L, Yu, Y, He, M, Zhou, X, Yang, L. Mechanisms by which silencing long-stranded noncoding RNA KCNQ1OT1 alleviates myocardial ischemia/reperfusion injury (MI/RI)-induced cardiac injury via miR-377-3p/HMOX1. BMC Cardiovasc Disord 2024;24:19. https://doi.org/10.1186/s12872-023-03693-y.Search in Google Scholar PubMed PubMed Central
22. Silva, SN. Special issue: genetic perspectives in thyroid cancer. Genes (Basel) 2021;12. https://doi.org/10.3390/genes12020126.Search in Google Scholar PubMed PubMed Central
23. Shi, P, Liu, Y, Yang, D, Wu, Y, Zhang, L, Jing, S, et al.. CircRNA ZNF609 promotes the growth and metastasis of thyroid cancer in vivo and in vitro by downregulating miR-514a-5p. Bioengineered 2022;13:4372–84. https://doi.org/10.1080/21655979.2022.2033015.Search in Google Scholar PubMed PubMed Central
24. Araque, DVP, Bleyer, A, Brito, JP. Thyroid cancer in adolescents and young adults. Future Oncol 2017;13:1253–61. https://doi.org/10.2217/fon-2017-0024.Search in Google Scholar PubMed
25. Alzumaili, B, Sadow, PM. Update on molecular diagnostics in thyroid pathology: a review. Genes (Basel) 2023;14. https://doi.org/10.3390/genes14071314.Search in Google Scholar PubMed PubMed Central
26. Ulisse, S, Baldini, E, Lauro, A, Pironi, D, Tripodi, D, Lori, E, et al.. Papillary thyroid cancer prognosis: an evolving field. Cancers (Basel) 2021;13. https://doi.org/10.3390/cancers13215567.Search in Google Scholar PubMed PubMed Central
27. Su, Y, Mei, L, Jiang, T, Wang, Z, Ji, Y. Novel role of lncRNAs regulatory network in papillary thyroid cancer. Biochem Biophys Rep 2024;38:101674. https://doi.org/10.1016/j.bbrep.2024.101674.Search in Google Scholar PubMed PubMed Central
28. Tao, T, Wu, S, Sun, Z, Ma, W, Zhou, S, Deng, J, et al.. The molecular mechanisms of LncRNA-correlated PKM2 in cancer metabolism. Biosci Rep 2019;39. https://doi.org/10.1042/bsr20192453.Search in Google Scholar
29. Li, R, Zhao, M, Sun, M, Miao, C, Lu, J. Construction and validation of a PANoptosis-related lncRNA signature for predicting prognosis and targeted drug response in thyroid cancer. PeerJ 2023;11:e15884. https://doi.org/10.7717/peerj.15884.Search in Google Scholar PubMed PubMed Central
30. Cao, HL, Liu, ZJ, Huang, PL, Yue, YL, Xi, JN. lncRNA-RMRP promotes proliferation, migration and invasion of bladder cancer via miR-206. Eur Rev Med Pharmacol Sci 2019;23:1012–21. https://doi.org/10.26355/eurrev_201902_16988.Search in Google Scholar PubMed
31. Shao, Y, Ye, M, Li, Q, Sun, W, Ye, G, Zhang, X, et al.. LncRNA-RMRP promotes carcinogenesis by acting as a miR-206 sponge and is used as a novel biomarker for gastric cancer. Oncotarget 2016;7:37812–24. https://doi.org/10.18632/oncotarget.9336.Search in Google Scholar PubMed PubMed Central
32. Yin, H, Chen, L, Piao, S, Wang, Y, Li, Z, Lin, Y, et al.. M6A RNA methylation-mediated RMRP stability renders proliferation and progression of non-small cell lung cancer through regulating TGFBR1/SMAD2/SMAD3 pathway. Cell Death Differ 2023;30:605–17. https://doi.org/10.1038/s41418-021-00888-8.Search in Google Scholar PubMed PubMed Central
33. Li, G, Kong, Q. LncRNA LINC00460 promotes the papillary thyroid cancer progression by regulating the LINC00460/miR-485-5p/Raf1 axis. Biol Res 2019;52:61. https://doi.org/10.1186/s40659-019-0269-9.Search in Google Scholar PubMed PubMed Central
34. He, Q, Yang, C, Xiang, Z, Huang, G, Wu, H, Chen, T, et al.. LINC00924-induced fatty acid metabolic reprogramming facilitates gastric cancer peritoneal metastasis via hnRNPC-regulated alternative splicing of Mnk2. Cell Death Dis 2022;13:987. https://doi.org/10.1038/s41419-022-05436-x.Search in Google Scholar PubMed PubMed Central
35. Fang, Y, Huang, S, Han, L, Wang, S, Xiong, B. Comprehensive analysis of peritoneal metastasis sequencing data to identify LINC00924 as a prognostic biomarker in gastric cancer. Cancer Manag Res 2021;13:5599–611. https://doi.org/10.2147/cmar.s318704.Search in Google Scholar
36. Yu, K, Mei, Y, Wang, Z, Liu, B, Deng, M. LncRNA LINC00924 upregulates NDRG2 to inhibit epithelial-mesenchymal transition via sponging miR-6755-5p in hepatitis B virus-related hepatocellular carcinoma. J Med Virol 2022;94:2702–13. https://doi.org/10.1002/jmv.27578.Search in Google Scholar PubMed
37. Zhang, W, Zhao, Y, Jia, Y, Bai, Y. Prognostic value of long noncoding RNA LINC00924 in lung adenocarcinoma and its regulatory effect on tumor progression. Histol Histopathol 2024;39:595–602. https://doi.org/10.14670/HH-18-642.Search in Google Scholar PubMed
38. Li, P, Wang, J, Zhi, L, Cai, F. Linc00887 suppresses tumorigenesis of cervical cancer through regulating the miR-454-3p/FRMD6-Hippo axis. Cancer Cell Int 2021;21:33. https://doi.org/10.1186/s12935-020-01730-w.Search in Google Scholar PubMed PubMed Central
39. Wu, Y, Yang, J, Zhang, H, Cheng, J, Lei, P, Huang, J. LncRNA H19 influences cellular activities via the miR-454-3p/BHLHE40 Axis in anaplastic thyroid carcinoma. Horm Metab Res 2024;56:392–9. https://doi.org/10.1055/a-2196-3511.Search in Google Scholar PubMed
© 2025 the author(s), published by De Gruyter, Berlin/Boston
This work is licensed under the Creative Commons Attribution 4.0 International License.
