Home Investigation of miR-144-3p expression levels in HbSS cases with high and normal HbF
Article Publicly Available

Investigation of miR-144-3p expression levels in HbSS cases with high and normal HbF

  • Figen Guzelgul ORCID logo EMAIL logo , Gönül Şeyda Seydel ORCID logo , Zeliha Nazan Alparslan and Kıymet Aksoy
Published/Copyright: July 12, 2020
Download Article (PDF)
Turkish Journal of Biochemistry
From the journal Turkish Journal of Biochemistry Volume 46 Issue 1

Abstract

Background

Sickle cell anemia (HbSS) is a hereditary blood disease that affects millions of people worldwide. Increased the HbF levels affects the clinical course of HbSS positively. The aim of this study was to investigate the association between miR-144-3p and HbSS.

Materials and methods

In this study 84 cases (44 HbSS/HbS combination and 40 HbAA) were performed. The expression of miR-144-3p was determined by RT-PCR. Statistical analysis was performed by the Mann-Whitney U test (SPSS 20.00 for Windows and p<0.005).

Results

The miR-144-3p expression levels were higher in the HbSS cases (p≤0.001). Additionally, it was determined that the expression of miR-144-3p was higher in the cases with HbF<3 (p=0.043).

Discussion

In our study, the increase in the miR-144-3p levels in low HbF levels may be associated with the severity of the disease.

Conclusion

Considering these results, suppressing miR-144-3p may be considered as a new treatment option in HbSS.

Öz

Amaç

Dünya’da milyonlarca insanı etkileyen orak hücreli anemi (Hb SS) bir kalıtsal kan hastalığıdır. Hb F düzeyinin yüksekliği Hb SS’in kliniğini pozitif yönde etkilemektedir. Bu çalışmadaki amacımız miR-144-3p ve HbSS’in birlikteliğini araştırmaktır.

Gereç ve Yöntemler

Bu çalışmada 84 olgunun (44 HbSS/HbS birlikteliği ve 40 HbAA) verileri değerlendirilmiştir. miR-144-3p’nin ekspresyonu RT-PCR ile belirlenmiştir. İstatistiksel analizler Mann-Whitney U testi (Windows SPSS 20.00 ve p<0.005) ile değerlendirilmiştir.

Sonuçlar

HbSS olgularında miR-144-3p’nin ekspresyonunun seviyesi daha yüksek olduğu belirlenmiştir (p ≤ 0.001). Buna ilaveten, Hb F < 3 olan olgularda miR-144-3p’nin ekspresyon düzeyinin daha yüksek olduğu saptanmıştır (p = 0.043).

Tartışma

Çalışmamızda Hb F düzeyi düşük olan olgularda miR-144-3p ekspresyonunun yüksekliği hastalığın şiddeti ile orantılı olabileceği gözlenmiştir.

Sonuç

Bu sonuçlar göz önünde bulundurulduğunda, miR-144-3p ekspresyonunun baskılanması Hb SS’nin tedavisinde yeni bir yaklaşım olabileceği düşünülmüştür.

Keywords: fetal hemoglobin; miRNA; sickle cell anemia
Anahtar Kelimeler: fetal hemoglobin; miRNA; orak hücreli anemi

Introduction

Sickle cell anemia (HbSS) is one of the most common blood diseases in the world, which is an autosomal recessive disorder of hemoglobin. It is caused by the substitution of glutamic acid (Glu) by valine (Val) at the sixth position of the β globin chain [HbS (β (6) GTG→GAG)] [1]. This single amino acid replacement leads to large changes in molecular stability and solubility. Erythrocytes that carry HbS that polymerizes deoxygenated conditions, leads to flexion in the red blood cells and it takes a sickle-shape. These cells have a short lifespan and lead to disruption in normal blood flow and local hypoxia by clogging the capillary blood vessels [2]. In HbSS, the βS globin chain is carried in the homozygous form. Clinical features of this disease include anemia, increase in the severity of some infections, tissue infractions that may lead to organ damage and recurring pains. HbA and HbS are found together in the erythrocytes of individuals who carry the HbS gene in the heterozygous form (HbA/S). Blood cell morphologies, physical development, activities and lifespan of individuals with sickle cell trait (HbAS) are generally normal. While HbS/β0 double heterozygous picture shows a clinical similarity to homozygous HbSS, HbS/β+ has a double heterozygous characteristic with mild or severe clinical signs. HbF (2α2γ), which is the major hemoglobin of fetal life and newborn, is the most significant modulator of the clinical and hematological features of HbSS. The combination of HbS/hereditary persistence of fetal hemoglobin (HbS/HPFH) leads to quite mild clinical symptoms [1], [3]. The fetal hemoglobin production of some cases with HPFH continues in adulthood. It has been reported that higher HbF levels not only prevent the polymerization of HbS but also play an important role in reducing rate of various complications of sickle cell disease (SCD) such as acute painful sickle cell episodes, leg ulcers and osteonecrosis [1], [3], [4]. Therefore, in recent years most researchers focus on agents that would increase the HbF values as effective treatments for HbSS [5].

MicroRNAs (miRNA) have a length of 19–25 nucleotides and are small non-coding RNAs that regulate gene expression by cleaving the target mRNA or preventing translation [6]. miRNAs play an important role in several cellular functions such as cell proliferation, differentiation, reproduction, apoptosis, oxidative stress and DNA repair. Furthermore, miRNAs have contributed to our understanding of the biology and pathophysiology of many diseases and epigenetic changes in the expression of genes [7].

The study conducted by Chen et al. which was carried out on mice for the first time showed that different miRNAs were expressed in hematopoietic cells [8]. In later years, it was shown that miRNAs are found in granulocytes, monocytes, lymphocytes, thrombocytes and reticulocytes of human beings [9], [10]. Additionally, it has been demonstrated that miRNAs also played a role in the hematopoietic cell differentiation, and the expression level of some miRNAs decreased or increased depending on the type of differentiated cells [11]. In some studies, it was reported that different types of miRNAs were found in matured erythrocytes and leukocytes and there was a statistically significant correlation between the severity of the SCD and the high level of leukocytes [8], [12], [13].

In this study, we aimed to investigate the changes in miR-144-3p expression associated with HbF induction in patients with HbSS/HbS combination.

Materials and methods

Sample selection

Ethical approval for the study was granted on by the Ethics Board of the Faculty of Medicine at Cukurova University. Blood samples were collected from patients visiting the Hereditary Blood Diseases Association of Adana and Departments of Pediatric Hematology and Medical Biochemistry at Cukurova University in Turkey. The study was conducted with participation of 44 HbSS/HbS combination (patient group) and 40 HbAA (control group). Additionally, patient group was divided into two groups according to their HbF levels: 11 cases with HbF<3% (group 1) and 20 cases with HbF>9% (group 2) to assess the effects on HbF levels of miRNA-144-3p. The interviews with the patient and control groups were conducted to collect data regarding their demographics. The mean age of the patient group was 31.66 years (18–65 years), the mean age of the control group was 23.66 years (6–48 years). The patient group was composed of 25 male (56.8%) and 19 female (43.2%). The control group was composed of 19 male (47.5%) and 21 female (52.5%). The information about gender and average age of the control and patient groups is given in Table 1.

Table 1:

Demographics of patients and healthy controls.

Patients n=44 n (%)Control Groups n = 40 n (%)
Gender
Male25 (56.8)19 (47.5)
Female19 (43.2)21 (52.5)
Age (years)
Medium31.6623.66
Range18–656–48

  1. n: number of cases.

A total of 5 mL of blood, 2.5 mL in EDTA tube and 2.5 mL in RNALater tube (PaxGene,Qiagen), was received from each case. The samples collected in the RNALater tubes were stored at −20 °C. The same procedure was applied for all cases at all stages of the experiment.

Hemoglobin typing

Hematological parameters were determined by a Sysmex-KX-21 N analyzer. Sickling test, cellulose acetate electrophoresis (Sartorius Stedim Biotech GmbH, Goettingen, Germany) and high-performance liquid chromatography [HPLC (Agilent 1100)] were performed for identities of hemoglobin types. DNAs were isolated by using MagNAPure LC Automated DNA Isolation Device (Roche Diagnostics, the Netherlands BV) and stored at +4 °C. Hemoglobin mutations were characterized by the ARMS and Gap-PCR.

miRNA isolation

The RNALater tubes were left at room temperature and homogenized. The erythrocytes were lysed and leukocytes were obtained by using a Red Blood Cell Lysis Buffer kit (Roche Diagnostics). A High Pure miRNA Isolation Kit (Roche Diagnostics) was used to obtain miRNA from the leukocytes. All samples were stored at −80 °C until use [14], [15].

cDNA synthesis

Complementary DNA (cDNA) was synthesised from the isolated RNA samples in 10 μl final reaction volumes using a miRCURY Universal cDNA Synthesis Kit (Exiqon). All reactions were performed as specified in the protocols of the manufacturer: 2 μL total RNA was added to 8 μL of the master mix consisting of 5x reaction buffer (2 μL), nuclease free water (4.5 μL), enzyme mix (1 μL), spike in (0.5 μL). The reactions were incubated at 42 °C for 60 min (1 cycle), at 95 °C for 5 min (1 cycle) and storage at +4 °C or −20 °C [16].

RT-PCR (real time PCR) analysis

The cDNAs that were obtained from all cases were used as a template and for each cDNA sample, the gene expression of miR-144-3p (UACAGUAUAGAUGAUGUACU) and the reference gene (U6) was analyzed by using a Roche LightCycler®480 Real-Time PCR instrument (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s protocol. Firstly, U6 and target gene (miR-144-3p) were diluted separately by using 220 µl of nuclease-free water. Reactions were performed in a final volume of 10 μL containing 5 μL of PCR SYBR green Master Mix, 1 μL of specific PCR primer (Exiqon), and 4 μL of cDNA template. Reactions were run on a Light Cycler 480 Real-Time PCR in 96-well optical plates. The cycle conditions were denaturation at 95 °C for 10 min, followed by 45 amplification cycles of 95 °C for 10 s and 60 °C for 60 s, melting curve at 95 °C for 30 s, 40 °C for 60 s, 85 °C for continued and cooling at 40 °C for 60 s. Calculation of quantification cycle (Cq) values for relative quantification were performed using Light Cycler 480 Software, Version 1.5 (Roche Diagnostics) [16]. The reference gene was used for the normalization of target gene expression. The fold change was calculated with the equation 2-∆∆Ct.

Statistical analysis

The miRNA expression levels of the control and patient groups were calculated by the formula of 2-∆∆Ct. Differences in the data were determinated by Mann-Whitney U test. The analyses were carried out by using SPSS 20.0 for Windows Program, and the statistically significant level was accepted as p<0.05. Additionally, the relationship between 11 cases with HbF<3% and 20 cases with HbF>9% and miR-144-3p levels were analyzed by using Mann-Whitney U test.

Results

Hemoglobin typing was carried out for all cases and was determined that 40 cases with HbAA, 35 cases of whom with HbSS, 7 cases with a combination of HbSS and −3.7α/AA, 1 case with a combination of HbSS and −20.5-/AA, and 1 case with the genotype of S/IVS1-110 by using molecular methods (Table 2).

Table 2:

Hemoglobin typing in all cases.

Hemoglobin typesNumbers
HbSS35
HbSS/-3.7α/αα7
HbSS/-20.5/αα1
HbS/IVS1-1101
HbAA40

The expression levels of the miR-144-3p target gene of the cases were determined by RT-PCR in all cases (Figure 1). The expression levels were calculated by the method of 2−∆∆Ct and the significance level based on the Mann-Whitney U test was found as p<0.001.

Figure 1: Determination of miR-144-3p gene (target) expression level by RT-PCR in all cases.
Figure 1:

Determination of miR-144-3p gene (target) expression level by RT-PCR in all cases.

Additionally, when the expression levels in patient group were compared between 11 cases with HbF<3% and 20 cases with HbF>9% in order to determine the effects of miR-144-3p on HbF levels, the significance value was found as p=0.043.

Discussion

Point mutations, insertions and deletions that take place in the exon parts or other parts of the genes that code the polypeptide chains of the hemoglobin molecule cause abnormal hemoglobin. Among abnormal hemoglobin changes, HbS [(β (6) GTG →GAG)] is known as the most prevalent hereditary blood disease in both Turkey and the world [17], [18]. HbA/S, HbSS, other abnormal hemoglobins and thalassemia mutations have been combined with HbS and this combination results in variable clinical manifestations [19]. There are several studies in the Human miRNA Disease Database (HMDD) related to miR-144 and human diseases [20]. In this study, it was observed that the expression levels of miRNA-144-3p were higher in the patient group at the steady state in comparison to those with control group (p<0.001). The study conducted by Swem et al. investigated expression of miRNA-144 of 20 HbSS steady state, 20 crisis state, 20 HbAA controls and 20 HbAS controls. According to their analyses, there was no significant difference (p>0.05) in the miRNA-144 levels between the HbSS cases at the crisis state and those at the stable state, while miRNA-144 showed a statistical significant difference between HbSS steady state and HbAS control; HbSS steady state and HbAA; HbSS crisis state and HbAA control (p<0.001) [21]. This study shows that a high level miRNA-144 in HbSS compared to HbAS and HbAA. These results are similar to our findings.

Uwaezuoke et al. evaluated the relationship between the severity of SCD and expression of miR-221 by leukocytes and 73 HbSS and 25 HbAA cases were analyzed. According to the findings of the study, leukocyte miR-221 was a strong correlate of SCD severity, and a candidate biomarker for assessing the disease severity at clinic [12].

Chen et al. examined the expression levels of miRNA-144 that were isolated from the erythrocytes of 12 HbSS and 7 HbAA cases and found that the miRNA-144 expression levels were higher in the HbSS cases [8]. Dore et al. investigated the function of miRNA-144 and miRNA-451 in hematopoietic cells. They reported that miRNA-144 and miRNA-451 acted as regulators of erythropoiesis by affecting the hematopoiesis transcription factor GATA-1 [22]. Keller et al. conducted a study on various types of cancer for determining the biomarker characteristics of miRNA-144. They reported that miRNA-144 and miRNA-20b levels were significantly lower in the cases with disease and AUC=0.771 (95% CI 0.721–0.821) was found through the ROC curve analysis [23].

The levels of fetal hemoglobin (HbF) are highly variable. It has high levels in the fetus and is produced at normal levels on adults with Hb S/A. HbF levels of adults with HbSS range is between %1 and %20. High HbF levels prevent sickling and causes less severe clinical course of HbS by inhibiting polymerization [24]. Because of these advantages, treatment methods that would increase HbF levels are utilized. Agents including hydroxyurea, epigenetic modifications (e.g. inhibition of γ globin gene promoter methylation or deacetylation with thalidomide and sodium butyrate) and miR-based regulation may be used for the purpose of treatment in SCD patients [25], [26].

Several studies have been conducted on the use of miR-144 in the treatment of hemoglobinopathies. Fu et al. asserted that erythroid specific miRNA-144 in zebra fish is specifically expressed during the developmental processes in embryogenesis, and it is a negative regulator of the α-globin gene by targeting KLFD. When the expression of miRNA-144 in zebra fish was inhibited, an increase was observed in the synthesis of the α-globin gene. Accordingly, the researchers aimed to develop a new treatment method for thalassemia cases by using miRNA-144 [27], [28].

Some studied have shown the relationship between miR-144 expression profiles in reticulocytes and erythrocytes in oxidative stress conditions [29], [30], [31]. According to Sangokoya study, miR-144 directly targets Nuclear related factor 2 (NRF2) which is the main factor in oxidative stress response and cellular antioxidant defense system. Higher levels of miR-144 expression in HbSS decrease the level of NRF2. Higher miR-144 expression is associated with severity of anemia and it results in hemoglobin/hematocrit cells to decrease. Moreover, increased values have been reported to cause the deficiency of antioxidant proteins such as glutamate-cysteine ligase, catalytic/modifier subunit (GCLC/M) and superoxide dismutase 1 (SOD1) [29].

Several studies have indicated that miR-144 and NRF2 expression were associated with oxidative stress, redox potential and anemia in SCD. Li et al. found out that miRNA-144 was highly expressed in SCD patients with high and low HbF levels. These results demonstrated that oxidative stress and inflammation play an important role in the pathophysiology of SCD, so drugs that induce HbF and reduce oxidative stress have a greater impact on clinical status [32].

Increased HbF levels causes more moderate clinical course of HbSS cases. HbSS cases were divided into groups based on their HbF levels to assess the usability of miRNA-144-3p in treatment. Considering the results of our analysis, it was found out that miR-144-3p had higher expression levels in the cases with HbF<3% (p=0.043).

Conclusion

In this study, we wanted to evaluate whether the expression levels of miR-144-3p could be used as potential treatments by determining the expression levels of miR-144-3p. The increased miRNA-144-3p expression in the patients group with low HbF values might be related to the severity of the disease. Suppressing miRNA-144-3p might be considered as a new treatment strategy for a milder clinical picture in HbSS cases. However, considering one miRNA could control multiple genes, and one gene could be controlled by multiple miRNAs, it was needed to conduct more comprehensive studies on usage of miRNAs in treatment and prognosis.

Corresponding author: Figen Guzelgul, PhD, Department of Biochemistry, Faculty of Pharmacy, Tokat Gaziosmanpasa University, TasliciftlikTokat, Turkey60250. Phone: +903562521616/1451, E-mail:

Funding source: Cukurova University Research Fund

Award Identifier / Grant number: TF2012D7

Award Identifier / Grant number: TF2012BAP18

Award Identifier / Grant number: TF2012BAP20

Award Identifier / Grant number: TF2012BAP22

Acknowledgments

In this article, findings from studied titled ‘Determination of miRNA expression levels by RT-PCR in sickle cell anemia cases,’ project no. TF2012D7, TF2012BAP18, TF2012BAP20 and TF2012BAP22 from the Cukurova University Research Fund, Adana, Turkey. We woluld like thank Blood Transfusion Research Center of Adana. This research was presented as an oral presentation at the 41st National Hematology Congress, Belek, 21–24 October 2015.

  1. Research funding: This work was supported by Cukurova University Research Fund, Adana, Turkey, project no. TF2012D7, TF2012BAP18, TF2012BAP20 and TF2012BAP22.

  2. Author Contributions: Concept: F.G., G.Ş.S.,K.A.; Design: F.G., G.Ş.S.,K.A.; Data Collection or Processing: F.G., K.A.,; Analysis or Interpretation: F.G., G.Ş.S., N.A., K.A., Literature: F.G., G.Ş.S.; Search: F.G., G.Ş.S.; Writing: F.G., G.Ş.S., N.A., K.A.

  3. Competing interests: The authors of this paper have no conflicts of interest, including specific financial interests, relationships and/or affiliations relevant to the subject matter or materials included.

  4. Informed consent: Informed consent was obtained from all individuals included in this study.

  5. Ethical approval: Ethical approval for the study was granted on by the Ethics Board of the Faculty of Medicine at Cukurova University( 03.05.2012). The study was done with informed constent forms from humans.

References

1. Koch, AA, Yang, Q, Olney, RS. Sickle hemoglobin (HbS) allele and sickle cell disease: aHuGEreview. Epidemiol 2000;151:839–45. https://doi.org/10.1093/oxfordjournals.aje.a010288.Search in Google Scholar

2. Stuart, M, Nagel, R. Sickle cell disease. Lancet 2004;364:1343–60. https://doi.org/10.1016/s0140-6736(04)17192-4.Search in Google Scholar

3. Akinsheye, I, Alsultan, A, Solovieff, N, Ngo, D, Baldwin, CT, Sebastiani, P, et al.. Fetal hemoglobin in sickle cell anemia. Blood 2011;118:19–27. https://doi.org/10.1182/blood-2011-03-325258.Search in Google Scholar

4. Platt, OS, Brambilla, DJ, Rosse, WF, Milner, PF, Castro, O, Steinberg, MH, et al.. Mortality in sickle cell disease. Life expectancy and risk factors for early death. N Engl J Med 1994;330:1639–44. https://doi.org/10.1056/nejm199406093302303.10.1056/NEJM199406093302303Search in Google Scholar PubMed

5. Fard, AD, Hosseini, SA, Shahjahani, M, Salari, F, Jaseb, K. Evaluation of novel fetal hemoglobin inducer drugs in treatment of β-Hemoglobinopathy disorders. Int J Hematol Oncol Stem Cell Res 2013;7:47–54. https://pubmed.ncbi.nlm.nih.gov/24505535/.Search in Google Scholar

6. Grasedieck, S, Sorrentino, A, Langer, C, Buske, C, Döhner, H, Mertens, D, et al.. Circulating MicroRNAs in hematological diseases: principles, challenges, and perspectives. Blood 2013;121:4977–84. https://doi.org/10.1182/blood-2013-01-480079.Search in Google Scholar

7. Ardekani, AM, Naeini, MM. The role of MicroRNAs in human diseases. Avicenna J Med Biotechnol 2010;2:161–79. https://pubmed.ncbi.nlm.nih.gov/23407304/.Search in Google Scholar

8. Chen, SY, Wang, Y, Telen, MJ, Chi, JT. The genomic analysis of erythrocyte MicroRNA expression in sickle cell diseases. PLoS One 2008;3:1–13. https://doi.org/10.1371/journal.pone.0002360.Search in Google Scholar

9. Azzouzi, I, Moest, H, Winkler, J, Fauchere, JC, Gerber, AP, Wollscheid, B, et al.. MicroRNA-96 directly inhibits γ-globin expression in human erythropoiesis. PLoS One 2011;6:1–11. https://doi.org/10.1371/journal.pone.0022838.Search in Google Scholar

10. Yang, GH, Wang, F, Yu, J, Yuan, JY, Zhang, JW. MicroRNAs are involved in erythroid differentiation control. J Cell Biochem 2009;107:548–56. https://doi.org/10.1002/jcb.22156.Search in Google Scholar

11. Budhu, A, Ji, J, Wang, XW. The clinical potential of MicroRNAs. J Hematol Onc 2010;3:1–7. https://doi.org/10.1186/1756-8722-3-37.Search in Google Scholar

12. Uwaezuoke, N, Emodi, I, Ikefuna, A, Oguonu, T, Okpala, I. MicroRNA 221 expression by leukocytes correlates with the clinical severity of sickle cell disease. Haematol Int J 2018;2:000130. https://doi.org/10.23880/hij-16000130.Search in Google Scholar

13. Okpala, I. The intriguing contribution of white blood cells to sickle cell disease-a red cell disorder. Blood Rev 2004;18:65–73. https://doi.org/10.1016/s0268-960x(03)00037-7.Search in Google Scholar

14. Roche Diagnositics. Red blood cell lysis buffer; January 2009. Version 7.0.10.1101/pdb.rec11955Search in Google Scholar

15. Roche Diagnositics. High pure miRNA isolation kit; 2008. Version 05.3.Search in Google Scholar

16. Exiqon. miRCURY LNATM Universal RT microRNA PCR; 2013. Version 5.3.Search in Google Scholar

17. Guzelgul, F, Yalın, AE, Aksoy, K. The first observation of two alpha globin mutations in Turkey: Hb Stanleyville II and a homozygous 5nt deletion. Turk J Biochem 2014;39:523–8. https://doi.org/10.5505/tjb.2014.31967.Search in Google Scholar

18. Ariyurek, SY, Yildiz, SM, Yalin, AE, Guzelgul, F, Aksoy, K. Hemoglobinopathies in Çukurova region and neighboring provinces. Hemoglobin 2016;40:168–72. https://doi.org/10.3109/03630269.2016.1155156.Search in Google Scholar

19. Figueiredo, MS. The compound state: Hb S/beta-thalassemia. Rev Bras Hematol Hemoter 2015;37:150–2. https://doi.org/10.1016/j.bjhh.2015.02.008.Search in Google Scholar

20. Cui Lab bioinformatics and systems biology. HMDDV 3.2: The human microRNA disease database version 3.2. https://www.cuilab.cn/hmdd (Last accessed: November 2018).Search in Google Scholar

21. Swem, CA, Ukaejiofo, EO, Obeagu, EI, Eluke, B. Expression of micro RNA 144 in sickle cell disease. Int J Curr Res Med Sci 2018;4:26–32. https://doi.org/10.22192/ijcrms.2018.04.03.004.Search in Google Scholar

22. Dore, LC, Amigo, JD, Dos Santos, CO, Zhang, Z, Gai, X, Tobias, JW, et al.. A GATA-1-regulated microRNA locus essential for erythropoiesis. Proc Natl Acad Sci USA 2008;105:3333–8. https://doi.org/10.1073/pnas.0712312105.Search in Google Scholar

23. Keller, A, Leidinger, P, Vogel, B, Backes, C, ElSharawy, A, Galata, V, et al.. miRNAs can be generally associated with human pathologies as exemplified for miR-144. BMC Med 2014;12:224. https://doi.org/10.1186/s12916-014-0224-0.Search in Google Scholar

24. Ngo, DA, Aygun, B, Akinsheye, I, Hankins, JS, Bhan, I, Luo, HY, et al.. Fetal haemoglobin levels and haematological characteristics of compound heterozygous for haemoglobin S and deletional hereditary persistence of fetal haemoglobin. Br J Haematol 2012;156:259–64. https://doi.org/10.1111/j.1365-2141.2011.08916.x.Search in Google Scholar

25. Saki, N, Abroun, S, Soleimani, M, Kavianpour, M, Shahjahani, M, Mohammadi-Asl, J, et al.. MicroRNA expression in β-thalassemia and sickle cell disease: a role in the induction of fetal hemoglobin. Cell 2016;17:583–92. https://doi.org/10.22074/cellj.2016.3808.Search in Google Scholar

26. Walker, AL, Steward, S, Howard, TA, Mortier, N, Smeltzer, M, Wang, Y-D, et al.. Epigenetic and molecular profiles of erythroid cells after hydroxylurea treatment in sickle cell anemia. Blood 2011;118:5664–70. https://doi.org/10.1182/blood-2011-07-368746.Search in Google Scholar

27. Fu, YF, Du, TT, Dong, M, Zhu, KY, Jing, CB, Zhang, Y, et al.. Mir-144 selectively regulates embryonic alpha-hemoglobin synthesis during primitive erythropoiesis. Blood 2009;113:1340–9. https://doi.org/10.1182/blood-2008-08-174854.Search in Google Scholar

28. Lawrie, CH. MicroRNA expression in erythropoiesis and erythroid disorders. Br J Haematol 2010;150:144–51. https://doi.org/10.1111/j.1365-2141.2009.07978.x.Search in Google Scholar

29. Sangokoya, C, Telen, MJ, Chi, JT. MicroRNA miR-144 modulates oxidative stres tolerance and associates with anemia severity in sickle cell disease. Blood 2010;116:4338–48. https://doi.org/10.1182/blood-2009-04-214817.Search in Google Scholar

30. miRBase. Stem-loop sequence hsa-mir-144. https://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0000460 (Last accessed: June 2019).Search in Google Scholar

31. Gene Cards. The human gene database. miR144 Gene (RNA Gene). https://www.genecards.org/cgi-bin/carddisp.pl?gene=MIR144 (Last accessed: June 2019).Search in Google Scholar

32. Li, B, Zhu, X, Ward, CM, Starlard-Davenport, A, Takezaki, M, Berry, A, et al.. MIR-144-mediated NRF2 gene silencing inhibits fetal hemoglobin expression in sickle cell disease. Exp Hematol 2019;70:85–96. https://doi.org/10.1016/j.exphem.2018.11.002.Search in Google Scholar

Received: 2019-11-28
Accepted: 2020-04-17
Published Online: 2020-07-12

© 2021 Figen Guzelgul et al., published by De Gruyter, Berlin/Boston

Articles in the same Issue

  1. Frontmatter
  2. Editorial
  3. Turkish journal of biochemistry is an open access journal again
  4. Review Articles
  5. A critical review on human serum Paraoxonase-1 in the literature: truths and misconceptions
  6. The effect of platelet rich plasma on radiotherapy
  7. Research Articles
  8. TBS preanalytical phase working group survey study – preanalytical phase in coagulation laboratories
  9. Lymphocyte-to-C-reactive protein ratio may serve as an effective biomarker to determine COVID-19 disease severity
  10. Evaluation of the performance of sysmex XN-3100 automated hematology analyzer regarding the sysmex XE-2100 and microscopic examination
  11. Evaluation of four different HPLC devices for hemoglobinopathy screening
  12. Reticulocyte hemoglobin equivalent in differential diagnosis of iron deficiency, iron deficiency anemia and β thalassemia trait in children.
  13. Investigation of miR-144-3p expression levels in HbSS cases with high and normal HbF
  14. The effect of diurnal variation on erythrocyte sedimentation rate
  15. Inhibition of apoptosis may lead to the development of bortezomib resistance in multiple myeloma cancer cells
  16. The role of the delta neutrophil index in determining the etiology of neonatal sepsis
  17. Effect of transportation and freeze-thaw procedure on hemostatic tests
  18. A data analysis study: is there a relationship between 25(OH)D deficiency and iron-deficient anaemia in the pediatric population?
  19. case-report
  20. First observation of hemoglobin G-Norfolk in the Turkish population
https://doi.org/10.1515/tjb-2019-0496
Keywords for this article
fetal hemoglobin; miRNA; sickle cell anemia

Articles in the same Issue

  1. Frontmatter
  2. Editorial
  3. Turkish journal of biochemistry is an open access journal again
  4. Review Articles
  5. A critical review on human serum Paraoxonase-1 in the literature: truths and misconceptions
  6. The effect of platelet rich plasma on radiotherapy
  7. Research Articles
  8. TBS preanalytical phase working group survey study – preanalytical phase in coagulation laboratories
  9. Lymphocyte-to-C-reactive protein ratio may serve as an effective biomarker to determine COVID-19 disease severity
  10. Evaluation of the performance of sysmex XN-3100 automated hematology analyzer regarding the sysmex XE-2100 and microscopic examination
  11. Evaluation of four different HPLC devices for hemoglobinopathy screening
  12. Reticulocyte hemoglobin equivalent in differential diagnosis of iron deficiency, iron deficiency anemia and β thalassemia trait in children.
  13. Investigation of miR-144-3p expression levels in HbSS cases with high and normal HbF
  14. The effect of diurnal variation on erythrocyte sedimentation rate
  15. Inhibition of apoptosis may lead to the development of bortezomib resistance in multiple myeloma cancer cells
  16. The role of the delta neutrophil index in determining the etiology of neonatal sepsis
  17. Effect of transportation and freeze-thaw procedure on hemostatic tests
  18. A data analysis study: is there a relationship between 25(OH)D deficiency and iron-deficient anaemia in the pediatric population?
  19. case-report
  20. First observation of hemoglobin G-Norfolk in the Turkish population
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 11.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/tjb-2019-0496/html
Scroll to top button