Startseite circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
Artikel Open Access

circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia

  • Jinlian Ren und Jing Cai EMAIL logo
Veröffentlicht/Copyright: 1. März 2023
Artikel downloaden (PDF)
Open Medicine
Aus der Zeitschrift Open Medicine Band 18 Heft 1

Abstract

Previous studies have indicated that the development of preeclampsia (PE) involves the regulation of circular RNA (circRNA). However, the role of hsa_circ_0014736 (circ_0014736) in PE remains unknown. Thus, the study proposes to reveal the function of circ_0014736 in the pathogenesis of PE and the underlying mechanism. The results showed that circ_0014736 and GPR4 expression were significantly upregulated, while miR-942-5p expression was downregulated in PE placenta tissues when compared with normal placenta tissues. circ_0014736 knockdown promoted the proliferation, migration, and invasion of placenta trophoblast cells (HTR-8/SVneo) and inhibited apoptosis; however, circ_0014736 overexpression had the opposite effects. circ_0014736 functioned as a sponge for miR-942-5p and regulated HTR-8/SVneo cell processes by interacting with miR-942-5p. Additionally, GPR4, a target gene of miR-942-5p, was involved in miR-942-5p-mediated actions in HTR-8/SVneo cells. Moreover, circ_0014736 stimulated GPR4 production through miR-942-5p. Collectively, circ_0014736 inhibited HTR-8/SVneo cell proliferation, migration, and invasion and induced cell apoptosis through the miR-942-5p/GPR4 axis, providing a possible target for the treatment of PE.

Keywords: preeclampsia; circ_0014736; miR-942-5p; GPR4

1 Introduction

Characterized by proteinuria and hypertension, preeclampsia (PE) affects 3–5% of pregnancies and leads to a wide range of pathophysiological processes, such as inadequate trophoblast invasion, inappropriate maternal vascular destruction, and impaired implantation [1,2]. PE is the major cause of high fetal morbidity and pregnancy-caused death [3]. The increased apoptosis and shallow trophoblastic invasion of cytotrophoblasts are the major triggers of PE [4]. The decreased invasiveness of trophoblasts leads to unsuccessful decidual spiral arteries remodeling and deprived maternal oxygen supply, which leads to the release of antiangiogenic factors, finally causing endothelial cell dysfunction and systemic inflammation [5,6]. Although there are a wide variety of studies on PE, the potential mechanism related to the pathogenesis of PE remains to be explored.

Circular RNA (circRNA) is generated by the back-splicing of precursor mRNA and is highlighted by a covalent bond linking a 5′ cap and 3′ polyadenylation tail, accounting for about 90% of all human transcriptomes [7]. CircRNA is more resistant to exonuclease-induced degradation [8]. Considerable evidence has suggested that circRNA is involved in the pathophysiological process of human diseases, including epithelial–mesenchymal transition (EMT) progress, tumorigenesis, cell apoptosis, and immune responses [9]. At the molecular level, circRNA mediates mRNA expression by sequestering proteins, interfering with pre-mRNA processing or trapping miRNA [10]. Some reports have indicated that the abnormal expression of circRNA in the maternal–fetal interface is related to the mechanism regarding the proliferation, metastasis, and apoptosis of trophoblast cells [11]. Besides, circRNAs are responsible for pregnancy-linked complications [12,13]. circ_0014736, a novel circRNA, is one of the top two upregulated circRNAs in PE placenta tissues, and its expression is associated with some pathways like apoptosis and wnt-signaling [14], suggesting the potential role of circ_0014736 in PE progression. However, no experimental data support the involvement of circ_0014736 in PE.

MicroRNA (miRNA) is a small single-stranded posttranscriptional regulatory molecule that regulates gene expression by promoting their degradation or inhibiting their translation [15]. It has been accepted that the biological processes of various cells, such as cell proliferation, angiogenesis, and cell development, involve the regulation of miRNA. A specific expression pattern of miRNAs has been found in placental tissues and human umbilical vein endothelial cells (HUVECs) [16,17]. Additionally, biological information analysis revealed that miRNA mediated transcriptional regulation, cell cycle, cell adhesion, mitogen-activated protein kinase signaling, and so on, in PE [18,19].

As predicted by online databases, we found that circ_0014736 might bind to miR-942-5p, and G protein-coupled receptor 4 (GPR4) could interact with miR-942-5p. Also, cross-sectional evidence has revealed that miR-942-5p contributes to cell proliferation and motility but impedes cell apoptosis in placenta trophoblast cells [20]. Meanwhile, a recent paper documented that GPR4 was overexpressed in PE placentas and weakened the proliferative and migratory abilities of placenta trophoblast cells [21]. Based on the above data, it is hypothesized that circ_0014736 mediates PE progression by the miR-942-5p/GPR4 pathway; however, the mechanism has not been reported. Thus, the study was organized to assess circ_0014736 expression in PE placenta tissues, explore its role during PE and identify the circRNA/miRNA/mRNA regulatory network in PE development.

2 Materials and methods

2.1 Clinical specimens

Twenty-eight pregnant women with PE and 28 normal pregnant women (volunteers) were selected from Anting Hospital, Jiading District as research subjects. PE diagnosis was performed according to the stipulation in Williams Obstetrics. Instantly after surgery, tissues were stored at −80°C for further gene expression analysis. The clinical characteristics of the study subjects are shown in Table 1.

Table 1

Clinical characteristics of the study samples

Characteristics Control (n = 28) PE (n = 28) P-value
Maternal age (years) 29.78 ± 5.60 30.05 ± 5.31 0.854
Gestational age (week) 38.20 ± 2.66 37.45 ± 3.15 0.340
BMI 26.65 ± 5.61 25.86 ± 4.67 0.569
Systolic blood pressure (mmHg) 118.03 ± 8.36 150.25 ± 18.42 0.000*
Diastolic blood pressure (mmHg) 73.64 ± 8.85 91.72 ± 12.64 0.000*
Neonatal weight (kg) 3.22 ± 0.35 2.62 ± 0.95 0.003*

Values were presented as mean ± SD (Student’s t-test). *, P < 0.05.

PE, preeclampsia.

  1. Ethics approval and consent to participate: The present study was approved by the ethical review committee of Anting Hospital, Jiading District. Written informed consent was obtained from all enrolled patients.

  2. Consent for publication: Patients agree to participate in this work

2.2 Cell culture

Human placenta trophoblast cells (HTR-8/SVneo) were purchased from Procell (Wuhan, China) and maintained in Roswell Park Memorial Institute-1640 (RPMI-1640; Biosun, Shanghai, China) added with 10% fetal bovine serum (FBS; Biosun) and 1% penicillin/streptomycin (Phygene, Fuzhou, China) at 37°C in a humid incubator with 5% CO2.

2.3 Cell transfection

According to the user’s manual, plasmids and oligonucleotides were transfected into HTR-8/SVneo cells at 50–80% confluence using FuGENE6 (Roche, Basel, Switzerland). Ribobio Co., Ltd (Guangzhou, China) synthesized the small interfering RNAs against circ_0014736 (si-hsa_circ_0014736#1 5′-TTCTGATGAGGCTGTGCAGAA-3′ and si-hsa_circ_0014736#2 5′-TTTCTGATGAGGCTGTGCAGA-3′), GPR4 (si-GPR4 5′-CGCCATCCCTCTACATCTTTGTCAT-3′), miR-942-5p mimics (miR-942-5p 5′-UCUUCUCUGUUUUGGCCAUGUG-3′), miR-942-5p inhibitors (anti-miR-942-5p 5′-CACAUGGCCAAAACAGAGAAGA-3′), and the respective controls (si-NC, miR-NC, and anti-miR-NC). The overexpression plasmid of circ_0014736 was built by Geneseed Co., Ltd (Guangzhou, China), using the pcD5-ciR vector (pcD-ciR).

Table 2

Primers sequences used for qRT-PCR

Name Sequences (5′–3′)
hsa_circ_0014736 Forward GAAAAGACAAAGTCCTCGAG
Reverse GGATACCTTCTGCACAGC
MEF2D Forward TATCAACAACAGCCGAGGCG
Reverse TCCGGGCGGGGAGAATAATA
miR-942-5p Forward GCGCGCTCTTCTCTGTTTTGGC
Reverse GTGCAGGGTCCGAGGT
GPR4 Forward GCCGTTGTCAAGACCGGG
Reverse GGAAATTTCAATGGGGGCAGG
GAPDH Forward CAAATTCCATGGCACCGTCA
Reverse GACTCCACGACGTACTCAGC
U6 Forward CTTCGGCAGCACATATACT
Reverse AAAATATGGAACGCTTCACG

2.4 Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was isolated using Axygen® RNA Miniprep Kit (Corning, Madison, New York) as instructed. After RNA quantity was measured using a UV-3100PC spectrophotometer, high-capacity cDNA synthesis kits (TaKaRa, Dalian, China) were used to reversely transcript RNA. qRT-PCR Mix (TaKaRa) was premixed with cDNA and primers and was then heated on a thermocycler (Stratagene, Santa Clara, CA, USA) to determine the cycle threshold of each sample. The 2−∆∆Ct method was used to analyze gene expression with U6 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as internal references. The sequence amplified using the qRT-PCR primer (Table 2) of circ_0014736 contains the head-to-tail splicing sites of circ_0014736, which can distinguish mature circ_0014736 from parental mRNA transcript MEF2D. The forward primer sequence of circ_0014736 is the 5514–5533 bases of the mature sequence, and the reverse primer sequence is the reverse complementary sequence of the 4–21 bases of the mature circ_0014736 sequence.

2.5 Identification of circRNA stability

The isolated RNA went through 20 min incubation with RNase R (Tiangen, Beijing, China) at 37°C. Besides, HTR-8/SVneo cells maintained in 12-well plates were co-incubated with Actinomycin D (2 μg/mL; Rechemscience, Shang, China) for 0, 6, 12, and 24 h. Finally, qRT-PCR was applied to detect circ_0014736 expression. Linear myocyte enhancer factor 2D (MEF2D) served as a control gene reference.

2.6 3-(4,5-Dimethylthazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay

HTR-8/SVneo cells were passaged in 96-well microplates (5,000 cells per well) and cultured for 16 h. Then, si-hsa_circ_0014736#1, si-hsa_circ_0014736#2, si-NC, hsa_circ_0014736, pcD-ciR, miR-942-5p, miR-NC, anti-miR-942-5p, anti-miR-NC, and si-GPR4 were transfected into the cells and cultured for 0, 1, 2, 3, and 4 days. The cells were incubated with MTT solution (Seebio Biotech, Shanghai, China) and dimethyl sulfoxide (Seebio Biotech) successively. At last, samples were analyzed by a microplate reader (BioTek, Winooski, VT, USA) with an absorbance of 570 nm.

2.7 5-Ethynyl-2′-deoxyuridine (EdU) assay

HTR-8/SVneo cells transfected with test compounds went through 48 h culture in 12-well plates. The cells were digested and seeded in 96-well plates supplemented with EdU-labeled medium. Then, cell proliferation was confirmed by analyzing the number of EdU-positive cells using an EdU staining kit (Ribobio) following the guidebook. In addition, the immunostainings were captured under a fluorescence microscope (Olympus, Tokyo, Japan).

2.8 Flow cytometry analysis

After various transfections, HTR-8/SVneo cells were collected and washed using phosphate buffer solution (PBS; Phygene). Annexin V-FITC apoptosis detection kit (Solarbio, Beijing, China) was then performed to detect cell apoptosis in accordance with the guidebook. In short, the cells were suspended in binding buffer, and cell concentration was adjusted to 1 × 105 cells per 100 μL PBS. The cells were incubated with Annexin V-FITC and propidium iodide in the dark. At last, a flow cytometer (Thermo Fisher, Waltham, MA, USA) was applied to analyze the samples.

2.9 Wound-healing assay

Cells were placed in six-well plates and treated with test compounds. When the low surface of the culture plates was filled with the cells, cell wounds were created by using pipette tips (Baisai, Shanghai, China). After removing floated cells and debris, the cells were maintained in serum-free medium for 24 h. The width of the scratch gaps was measured at 0 and 24 h after serum-free cell culture under a low-power microscope (40× magnification; Olympus).

2.10 Transwell assay

The assay was carried out on HTR-8/SVneo cells grown in 12-well chambers added with 100 μL Matrigel (Corning). In brief, 5 × 104 cells were mixed with serum-free RPMI-1640 (Biosun) and then added into the upper insert of each chamber, while the medium containing 15% FBS (Biosun) was placed into the lower inserts to serve as chemoattractants. After 24 h, the cells that went through the membranes were fixed and stained with methanol (Seebio Biotech) and crystal violet (Seebio Biotech), respectively. The cells in six representative fields were determined under a high-power microscope (100× magnification; Olympus).

2.11 Western blot analysis

Total proteins from HTR-8/SVneo cells were extracted by using western cell lysis buffer (Sangon, Shanghai, China). The lysates were mixed with loading buffer (Thermo Fisher) and heated at 95°C to denature the proteins. Then, 20 μg of protein was placed in the holes of SurePAGE gels (Sangon) and electrophoresed through XCell4 SureLock Electrophoresis System (Thermo Fisher). After the proteins were wet-transferred onto nitrocellulose membranes, skimmed milk was used to block aspecific signals. The primary antibodies specific for proliferating cell nuclear antigen (PCNA), cleaved-caspase 3 (c-caspase 3), matrix metalloprotein 9 (MMP-9), GPR4 and GAPDH were used to incubate the membranes at a dilution of 1:1,000. Subsequent steps were carried out using a Western kit (Sangon). GAPDH was used to normalize protein expression. All antibodies were provided by Cusabio Biotech (Wuhan, China) or Sigma (St Louis, MO, USA).

2.12 Dual-luciferase reporter assay

Circular RNA interactome (https://circinteractome.nia.nih.gov/index.html) and targetscan online databases (http://www.targetscan.org/vert_71/) were conducted to predict the complementary sites of miR-942-5p with circ_0014736 and GPR4. Then, the sequences of circ_0014736 and GPR4 3′-untranslated region (3′-UTR) carrying the binding sites of miR-942-5p were amplified by qRT-PCR to build the wild-type (WT) plasmids (hsa_circ_0014736-WT and GPR4 3′-UTR-WT). The complementary sites within circ_0014736 and GPR4 3′-UTR were mutated by GenScript Biotech Corporation (Nanjing, China) to build the mutant (MUT) plasmids including hsa_circ_0014736-MUT and GPR4 3′-UTR-MUT. For cell transfection, the reporter vectors were mixed with FuGENE6 (Roche) and added into 24-well plates together with miR-942-5p or miR-NC. After 48 h of transfection, the luciferase activity of HTR-8/SVneo cells was monitored using Dual-Lucy Assay Kit (Solarbio).

2.13 RNA immunoprecipitation (RIP) assay

HTR-8/SVneo cells were collected and lysed using RIP lysis buffer (Sangon) containing RNasin (TaKaRa). The proteins that bound to the antibodies against AGO2 (anti-AGO2) and IgG (anti-IgG) were enriched by using a Magna RIP kit (Millipore, Billerica, MA, USA) following the standard procedures. qRT-PCR was applied to quantify circ_0014736 and miR-942-5p expression.

2.14 Biotin-labeled pull-down assay

GenePharma Company (Shanghai, China) provided biotin-labeled miR-942-5p (Biotin-miR-942-5p) and miR-NC (Biotin-NC). This assay was carried out on HTR-8/SVneo cells. Briefly, the cells were treated with the above probes and cultured for 48 h. Then, the cells were lysed and incubated with Streptavidin MagneSphere (Sigma) for 4 h. At last, circ_0014736 and GPR4 expression were monitored by qRT-PCR.

2.15 Statistical analysis

All data were obtained from three independent biological experiments, and data analysis was conducted using GraphPad Prism software. Results are expressed as mean ± standard deviation. Difference analysis was performed by Mann–Whitney U-test or Student’s t-test between the two groups and implemented by one-way analysis of variance among three or more groups. P < 0.05 indicated a statistical difference.

3 Results

3.1 circ_0014736 expression was upregulated in PE placenta tissues

circ_0014736 is located in chr1: 156433519–156453222 and is formed by the cyclization of exons 2–12 of the MEF2D gene (Figure 1a). Currently, there are no data regarding the role of circ_0014736 in the pathological genesis of PE. To analyze the role of circ_0014736 in PE, qRT-PCR was performed to detect circ_0014736 expression in PE placenta tissues. As shown in Figure 1b, circ_0014736 was overexpressed in PE placenta tissues when compared with normal placenta tissues. Subsequently, RNase R treatment did not affect the expression of circ_0014736 but significantly reduced MEF2D expression (Figure 1c). Also, the data from Figure 1d showed that the transcript half-life of circ_0014736 exceeded 24 h, although that of linear MEF2D was about 12 h. Taken together, these data indicated the pathological genesis of PE might involve circ_0014736.

Figure 1 Expression of circ_0014736 in PE tissues. (a) circ_0014736 was formed by the cyclization of exons 2–12 of the MEF2D gene. (b) circ_0014736 expression was detected by qRT-PCR in PE placenta tissues (N = 28) and normal placenta tissues (N = 28). (c and d) Stability of circ_0014736 was identified by RNase R and Actinomycin D treatment assays. **P < 0.01 and ***P < 0.001. Three independent duplicate tests were performed in (c) and (d).
Figure 1

Expression of circ_0014736 in PE tissues. (a) circ_0014736 was formed by the cyclization of exons 2–12 of the MEF2D gene. (b) circ_0014736 expression was detected by qRT-PCR in PE placenta tissues (N = 28) and normal placenta tissues (N = 28). (c and d) Stability of circ_0014736 was identified by RNase R and Actinomycin D treatment assays. **P < 0.01 and ***P < 0.001. Three independent duplicate tests were performed in (c) and (d).

3.2 circ_0014736 inhibited the proliferation, migration, and invasion and induced apoptosis of HTR-8/SVneo cells

The study then explored the function of circ_0014736 in the biological behaviors of HTR-8/SVneo cells, including cell proliferation, migration, invasion, and apoptosis, by silencing and overexpressing circ_0014736. The data from Figure 2a and b showed the high efficiency of circ_0014736 knockdown and overexpression. Subsequently, circ_0014736 depletion increased HTR-8/SVneo cell proliferation, but circ_0014736 overexpression displayed the opposite effects (Figure 2c–f). circ_0014736 absence inhibited the apoptosis of HTR-8/SVneo cells, whereas circ_0014736 introduction promoted cell apoptosis (Figure 2g and h). Consistently, the migration and invasion of HTR-8/SVneo cells were enhanced after circ_0014736 depletion but weakened by the enforced expression of circ_0014736 (Figure 2i–l). The study further detected the expression of proliferation-related PCNA, apoptosis-related c-caspase 3, and metastasis-related MMP-9 in the HTR-8/SVneo cells. As expected, circ_0014736 knockdown increased the expression of PCNA and MMP-9 and decreased c-caspase 3 expression; however, ectopic circ_0014736 expression had the opposite effects (Figure 2m and n). Thus, the above data manifested that circ_0014736 could induce HTR-8/SVneo cell dysfunction.

Figure 2 Effects of circ_0014736 on the proliferation, migration, invasion, and apoptosis of HTR-8/SVneo cells. (a and b) Efficiency of circ_0014736 knockdown and overexpression was determined by qRT-PCR in HTR-8/SVneo cells. HTR-8/SVneo cells were transfected with si-NC, si-hsa_circ_0014736#1, and si-hsa_circ_0014736#2 (c, e, g, i, k, and m), or pcD-ciR and hsa_circ_0014736 (d, f, h, j, l, and n). (c–f) Cell proliferation was investigated by MTT and EdU assays. (g and h) Cell apoptosis was quantified by flow cytometry analysis. (i–l) Migration and invasion were evaluated by wound-healing and transwell assays, respectively. (m and n) Expression of PCNA, c-caspase 3, and MMP-9 was checked by western blot. *P < 0.05, **P < 0.01, and ***P < 0.001. Three independent duplicate tests were performed in each experiment.
Figure 2

Effects of circ_0014736 on the proliferation, migration, invasion, and apoptosis of HTR-8/SVneo cells. (a and b) Efficiency of circ_0014736 knockdown and overexpression was determined by qRT-PCR in HTR-8/SVneo cells. HTR-8/SVneo cells were transfected with si-NC, si-hsa_circ_0014736#1, and si-hsa_circ_0014736#2 (c, e, g, i, k, and m), or pcD-ciR and hsa_circ_0014736 (d, f, h, j, l, and n). (c–f) Cell proliferation was investigated by MTT and EdU assays. (g and h) Cell apoptosis was quantified by flow cytometry analysis. (i–l) Migration and invasion were evaluated by wound-healing and transwell assays, respectively. (m and n) Expression of PCNA, c-caspase 3, and MMP-9 was checked by western blot. *P < 0.05, **P < 0.01, and ***P < 0.001. Three independent duplicate tests were performed in each experiment.

3.3 circ_0014736 acted as a sponge for miR-942-5p

MiRNA with the potential to bind to circ_0014736 was analyzed in this part. As a result, it was found that circ_0014736 potentially targeted miR-942-5p (Figure 3a). To analyze the potential binding relationship of circ_0014736 and miR-942-5p, the efficiency of miR-942-5p overexpression was detected. As shown in Figure 3b, the transfection with miR-942-5p mimics significantly increased miR-942-5p expression in HTR-8/SVneo cells, which indicated the high efficiency of miR-942-5p mimics in increasing miR-942-5p expression. Then, we found that miR-942-5p overexpression inhibited the luciferase activity of the WT reporter plasmid of hsa_circ_0014736 but not the luciferase activity of mutant reporter plasmid of hsa_circ_0014736 (Figure 3c). The RIP assay showed that both circ_0014736 and miR-942-5p were significantly enriched in the anti-AGO2 group when compared with the anti-IgG group in HTR-8/SVneo cells (Figure 3d). Moreover, biotin-labeled miR-942-5p could dramatically enrich circ_0014736 when compared with circ_0014736 expression in the control groups (Figure 3e). The above findings confirmed that circ_0014736 bound to miR-942-5p in HTR-8/SVneo cells. Subsequent data showed that circ_0014736 negatively regulated miR-942-5p expression. For instance, circ_0014736 depletion increased miR-942-5p expression, but circ_0014736 overexpression decreased the expression of miR-942-5p (Figure 3f and g). In support, Spearman correlation analysis showed the negative correlation of circ_0014736 and miR-942-5p expression in PE placenta tissues (Figure 3h). Comparatively, miR-942-5p was weakly expressed in PE placenta tissues (Figure 3i). Based on these data, miR-942-5p was employed as the follow-up study subject.

Figure 3 circ_0014736 interacted with miR-942-5p. (a) Binding sites of circ_0014736 for miR-942-5p. (b) Efficiency of miR-942-5p overexpression was determined by qRT-PCR in HTR-8/SVneo cells. (c–e) Dual-luciferase reporter, RIP, and RNA pull-down assays were used to identify the interaction of circ_0014736 and miR-942-5p. (f and g) Effects of circ_0014736 knockdown and overexpression on miR-942-5p expression were analyzed by qRT-PCR in HTR-8/SVneo cells. (h) Correlation between circ_0014736 and miR-942-5p expression was analyzed by Spearman correlation analysis in PE placenta tissues. (i) MiR-942-5p expression was determined by qRT-PCR in PE placenta tissues (N = 28) and normal placenta tissues (N = 28). **P < 0.01 and ***P < 0.001. Three independent duplicate tests were performed in (c–g).
Figure 3

circ_0014736 interacted with miR-942-5p. (a) Binding sites of circ_0014736 for miR-942-5p. (b) Efficiency of miR-942-5p overexpression was determined by qRT-PCR in HTR-8/SVneo cells. (c–e) Dual-luciferase reporter, RIP, and RNA pull-down assays were used to identify the interaction of circ_0014736 and miR-942-5p. (f and g) Effects of circ_0014736 knockdown and overexpression on miR-942-5p expression were analyzed by qRT-PCR in HTR-8/SVneo cells. (h) Correlation between circ_0014736 and miR-942-5p expression was analyzed by Spearman correlation analysis in PE placenta tissues. (i) MiR-942-5p expression was determined by qRT-PCR in PE placenta tissues (N = 28) and normal placenta tissues (N = 28). **P < 0.01 and ***P < 0.001. Three independent duplicate tests were performed in (c–g).

3.4 miR-942-5p attenuated the effects of circ_0014736 overexpression on HTR-8/SVneo cell processes

Whether miR-942-5p participated in circ_0014736-induced HTR-8/SVneo cell disorder was analyzed in this part. Figure 4a first showed that circ_0014736 overexpression reduced miR-942-5p expression, whereas the effect was relieved after transfection with miR-942-5p. Then, the inhibitory impact of the enforced circ_0014736 expression on HTR-8/SVneo cell proliferation was remitted after miR-942-5p introduction (Figure 4b and c). The addition of circ_0014736 expression promoted HTR-8/SVneo cell apoptosis, which was rescued by the increased expression of miR-942-5p (Figure 4d). A similar pattern of data among various groups was also found from wound-healing and transwell assays (Figure 4e and f). Consistently, miR-942-5p introduction restored the decreased expression of PCNA and MMP-9 and increased c-caspase 3 expression caused by circ_0014736 (Figure 4g). Thus, these results demonstrated that circ_0014736-induced dysfunction of HTR-8/SVneo cells involved miR-942-5p.

Figure 4 Effects of circ_0014736 and miR-942-5p overexpression on the proliferation, migration, invasion, and apoptosis of HTR-8/SVneo cells. (a–g) HTR-8/SVneo cells were transfected with pcD-ciR, hsa_circ_0014736, hsa_circ_0014736 + miR-NC, or hsa_circ_0014736 + miR-942-5p, and miR-942-5p expression was detected by qRT-PCR (a), cell proliferation by MTT and EdU assays (b and c), cell apoptosis by flow cytometry analysis (d), cell migration by wound-healing assay (e), cell invasion by transwell assay (f), and the protein expression of PCNA, c-caspase 3, and MMP-9 by western blot analysis (g). *P < 0.05, **P < 0.01, and ***P < 0.001. Three independent duplicate tests were performed in each experiment.
Figure 4

Effects of circ_0014736 and miR-942-5p overexpression on the proliferation, migration, invasion, and apoptosis of HTR-8/SVneo cells. (a–g) HTR-8/SVneo cells were transfected with pcD-ciR, hsa_circ_0014736, hsa_circ_0014736 + miR-NC, or hsa_circ_0014736 + miR-942-5p, and miR-942-5p expression was detected by qRT-PCR (a), cell proliferation by MTT and EdU assays (b and c), cell apoptosis by flow cytometry analysis (d), cell migration by wound-healing assay (e), cell invasion by transwell assay (f), and the protein expression of PCNA, c-caspase 3, and MMP-9 by western blot analysis (g). *P < 0.05, **P < 0.01, and ***P < 0.001. Three independent duplicate tests were performed in each experiment.

3.5 circ_0014736 modulated GPR4 expression through miR-942-5p

To determine whether GPR4 participated in the regulation of miR-942-5p in HTR-8/SVneo cell processes, we predicted the binding sites of miR-942-5p for GPR4 using targetscan online database. As shown in Figure 5a, GPR4 carried the complementary sites of miR-942-5p. Dual-luciferase reporter assay displayed that the luciferase activity of the WT reporter plasmid of GPR4 3′-UTR was inhibited after transfection with miR-942-5p mimics; however, the luciferase activity of mutant GPR4 3′-UTR had no response to miR-942-5p overexpression (Figure 5b). RNA pull-down assay showed that biotinylated miR-942-5p significantly enriched GPR4 in HTR-8/SVneo cells when compared with the controls (Figure 5c). The above results suggested that GPR4 was a target mRNA of miR-942-5p. Thus, GPR4 was employed in the following assays. Subsequently, we found that miR-942-5p introduction reduced GPR4 expression (Figure 5d). GPR4 expression was upregulated after miR-942-5p depletion (Figure 5e). Consistently, the study corroborated that circ_0014736 positively regulated GPR4 expression (Figure 5f and g). For instance, circ_0014736 knockdown decreased GPR4 expression, but circ_0014736 overexpression had the opposite effect. The data from Figure 5h and i showed that GPR4 was augmented in PE tissues in comparison with the controls. In support, GPR4 was negatively correlated with miR-942-5p expression but positively with circ_0014736 in PE tissues (Figure 5j and k). As expected, the addition of circ_0014736 expression elevated GPR4 expression, which was attenuated after miR-942-5p overexpression (Figure 5l). Taken together, these data demonstrated that circ_0014736 could mediate GPR4 expression through miR-942-5p.

Figure 5 circ_0014736 regulated GPR4 expression by miR-942-5p. (a) Binding sites of miR-942-5p for GPR4 3′-UTR. (b and c) Dual-luciferase reporter and RNA pull-down assays were performed to determine the interaction of GPR4 and miR-942-5p. (d and e) Effects of miR-942-5p overexpression and knockdown on GPR4 protein expression were investigated by western blot. (f and g) Western blot analysis was used to analyze the effects of circ_0014736 silencing and overexpression on GPR4 protein expression. (h and i) Protein and mRNA expression of GPR4 were detected by qRT-PCR and western blot analysis, respectively, in PE placenta tissues and normal placenta tissues. (j and k) Spearman correlation analysis was employed to determine the correlation between GPR4 and miR-942-5p or circ_0014736 in PE tissues. (l) Impacts between circ_0014736 and miR-942-5p overexpression on GPR4 protein expression were analyzed by western blot analysis. *P < 0.05, **P < 0.01, and ***P < 0.001. Three independent duplicate tests were performed in (b–h and l).
Figure 5

circ_0014736 regulated GPR4 expression by miR-942-5p. (a) Binding sites of miR-942-5p for GPR4 3′-UTR. (b and c) Dual-luciferase reporter and RNA pull-down assays were performed to determine the interaction of GPR4 and miR-942-5p. (d and e) Effects of miR-942-5p overexpression and knockdown on GPR4 protein expression were investigated by western blot. (f and g) Western blot analysis was used to analyze the effects of circ_0014736 silencing and overexpression on GPR4 protein expression. (h and i) Protein and mRNA expression of GPR4 were detected by qRT-PCR and western blot analysis, respectively, in PE placenta tissues and normal placenta tissues. (j and k) Spearman correlation analysis was employed to determine the correlation between GPR4 and miR-942-5p or circ_0014736 in PE tissues. (l) Impacts between circ_0014736 and miR-942-5p overexpression on GPR4 protein expression were analyzed by western blot analysis. *P < 0.05, **P < 0.01, and ***P < 0.001. Three independent duplicate tests were performed in (b–h and l).

3.6 GPR4 knockdown relieved the effects of miR-942-5p depletion on the proliferation, migration, invasion, and apoptosis of HTR-8/SVneo cells

The study continued to analyze whether miR-942-5p regulated HTR-8/SVneo cell processes by interacting with GPR4. Before that, we identified the efficiency of GPR4 knockdown (Figure 6a). Subsequently, the reduced expression of miR-942-5p promoted GPR4 protein production, which was reversed after GPR4 knockdown (Figure 6b). The proliferation of HTR-8/SVneo cells was inhibited after miR-942-5p silencing, whereas the decreased expression of GPR4 restored the effect (Figure 6c and d). Comparatively, the transfection with miR-942-5p inhibitors promoted cell apoptosis, but the decreased expression of GPR4 remitted the effect (Figure 6e). Besides, the data from Figure 6f and g also displayed that the decrease in GPR4 expression rescued the inhibitory impacts of miR-942-5p inhibitors on the migration and invasion of HTR-8/SVneo cells. In support, the decreased expression of PCNA and MMP-9 and the increased expression of c-caspase 3 by miR-942-5p inhibitors were remitted after GPR4 depletion (Figure 6h). By and large, these data manifested that miR-942-5p-triggered HTR-8/SVneo cell disorder involved GPR4.

Figure 6 Effects between miR-942-5p inhibitors and GPR4 knockdown on the proliferation, migration, invasion, and apoptosis of HTR-8/SVneo cells. (a) Knockdown efficiency of GPR4 was determined by western blot in HTR-8/SVneo cells. (b–h) HTR-8/SVneo cells were transfected with anti-miR-NC, anti-miR-942-5p, anti-miR-942-5p + si-NC, or anti-miR-942-5p + si-GPR4, and protein expression of GPR4, PCNA, c-caspase 3, and MMP-9 was determined by western blot (b and h), cell proliferation by MTT and EdU assays (c and d), apoptosis by flow cytometry analysis (e), cell migration by wound-healing assay (f), and cell invasion by transwell assay (g). *P < 0.05, **P < 0.01, and ***P < 0.001. Three independent duplicate tests were performed in each experiment.
Figure 6

Effects between miR-942-5p inhibitors and GPR4 knockdown on the proliferation, migration, invasion, and apoptosis of HTR-8/SVneo cells. (a) Knockdown efficiency of GPR4 was determined by western blot in HTR-8/SVneo cells. (b–h) HTR-8/SVneo cells were transfected with anti-miR-NC, anti-miR-942-5p, anti-miR-942-5p + si-NC, or anti-miR-942-5p + si-GPR4, and protein expression of GPR4, PCNA, c-caspase 3, and MMP-9 was determined by western blot (b and h), cell proliferation by MTT and EdU assays (c and d), apoptosis by flow cytometry analysis (e), cell migration by wound-healing assay (f), and cell invasion by transwell assay (g). *P < 0.05, **P < 0.01, and ***P < 0.001. Three independent duplicate tests were performed in each experiment.

4 Discussion

In contrast to late PE, early PE is more associated with increased severity of complications [22]. At present, the mechanisms behind PE progression are still poorly understood due to many complex pathophysiological factors in the process. Increasing evidence has confirmed the association of circRNA with PE progression [11]. HTR-8/SVneo cells are commonly used to investigate trophoblast biology and placental function, contributing to understanding the pathophysiological mechanisms of diseases related to inadequate placentation invasiveness in PE [23]. Under the above research background, the study was designed to explore the role of circ_0014736 in PE progression using HTR-8/SVneo cells. As a result, we found that circ_0014736 expression was upregulated in PE placenta tissues. circ_0014736 inhibited HTR-8/SVneo cell proliferation, migration, invasion, and induced apoptosis. In terms of mechanism, circ_0014736 induced GPR4 production through miR-942-5p.

Numerous data suggested the pathophysiological mechanisms of PE involved circRNA. For instance, circ_0001438 expression was enhanced in PE specimens, and circ_0001438 silencing promoted cell proliferation and motility but impeded inflammation through miR-942 in the placenta trophoblast cells [20]. CircRNA adenylate kinase 2 weakened trophoblast cell proliferation and metastasis, and the underneath mechanism was attributed to the miR-454-3p/thrombospondin 2 pathway [24]. Besides, circRNA trinucleotide repeat containing 18 sponged miR-762 to induce grainyhead like transcription factor 2, enhancing trophoblast cell migration and EMT [25]. In this work, circ_0014736, located on chr1: 156433519–156453222 and formed by the cyclization of exons 2–12 of the MEF2D gene, was discovered for the first time to regulate placenta trophoblast cell processes. Herein, circ_0014736 was upregulated in PE placentas when compared to normal placental tissues. Functional studies showed that circ_0014736 knockdown contributed to cell proliferation and metastasis but reduced cell apoptotic rate; however, circ_0014736 overexpression showed the opposite effects. These data indicated that circ_0014736 might act as a promoter in PE progression.

Given that circRNA generally acted as a sponge of miRNA to function in different types of diseases, we continued to analyze circ_0014736-related miRNAs. Through the prediction of online databases (circular RNA interactome and targetscan) and verification of mechanism assays, miR-942-5p was chosen as the target miRNA of circ_0014736. MiR-942-5p, a newly detected miRNA, is responsible for the mechanisms of multiple diseases, such as septic acute kidney injury [26], cancers [27,28], atherosclerosis [29], and attention deficit hyperactivity disorder [30]. Recently, some investigators found that miR-942-5p was poorly expressed in women with PE in comparison with women with uncomplicated pregnancies, and its depletion inhibited extravillous trophoblast cell viability and HUVEC angiogenesis [31]. In this work, miR-942-5p was weakly expressed in PE tissues when compared to normal placentas, and miR-942-5p contributed to cell proliferation and motility and repressed cell apoptosis in HTR-8/SVneo cells, which were in line with the reports from Li and his colleagues [20]. Besides, our data suggested that circ_0014736 accelerated the dysfunction of HTR-8/SVneo cells by binding to miR-942-5p.

GPR4, a proton-sensing receptor, is a member of proton-sensing G-protein coupled receptor family that helps cells sense extracellular acidification [32]. As reported, GPR4 participates in the immune response by recruiting monocytes and neutrophils [33,34]. Besides, GPR4 regulated cell metastatic ability and apoptosis in some types of cancers [35,36]. Recent studies indicated that GPR4-linked G protein-coupled receptors were associated with embryonic gastrulation [37]. Previous analysis also suggested that sphingosylphosphorylcholine-induced endothelial tube formation involved the regulation of GPR4 [38]. Another research suggested that GPR4 controlled central blood pressure through interaction with the renin-angiotensin system [39]. In this respect, Qi et al. have reported that GPR4 is highly expressed in HTR8/SVneo cells under acidosis and hypoxia environments [21]. In the present study, GPR4 was verified as a target mRNA of miR-942-5p and negatively regulated by miR-942-5p. Consistent with the published data [21], GPR4 was overexpressed in PE placenta tissues, and its knockdown promoted cell proliferation and migration in HTR8/SVneo cells. Beyond that, our data also found that GPR4 contributed to cell apoptosis and inhibited cell invasion in HTR8/SVneo cells.

Based on the above results, we further analyzed the association between circ_0014736 and GPR4. As a result, the study found that circ_0014736 knockdown reduced GPR4 expression, whereas high circ_0014736 expression had the opposite effect. Also, we found a negative correlation of circ_0014736 expression with GPR4 expression. Rescue assay further showed that circ_0014736-induced upregulation of FPR4 was relieved by the increased expression of miR-942-5p. Thus, circ_0014736 induced HTR8/SVneo cell dysfunction through the miR-942-5p/GPR4 pathway.

Some limitations should be considered when evaluating our findings. First, HTR8/SVneo cells used in this study contained a heterogeneous population of trophoblast and stromal cells [40], and other cell lines, such as BeWo, JEG-3, and JAR, should be chosen to evaluate the new mechanism. Additionally, the findings were only testified in vitro, and the mouse model of PE needed to be established to further validate the new mechanism.

5 Conclusion

Taken together, the dysfunction of HTR8/SVneo cells in PE involved the high expression of circ_0014736. The ectopic expression of circ_0014736 induced GPR4 production in a miR-942-5p-dependent manner, thereby inhibiting the proliferation, migration, and invasion of HTR8/SVneo cells and inducing cell apoptosis (Figure 7). The novel pathway highlights a new regulatory mechanism for circ_0014736 in PE pathogenesis. Additionally, the study also suggests the potential of circ_0014736 as a therapeutic target for PE. In particular, the inhibitors of circ_0014736 or GPR4 and the mimics of miR-942-5p are potential therapeutic agents for PE. However, due to lack of funding, more evidence showing the application of circ_0014736, miR-942-5p, or GPR4 in the treatment of PE needs to be explained in future studies.

Figure 7 Schematic diagram showed the mechanism of circ_0014736 regulating human placental trophoblast cell dysfunction in PE.
Figure 7

Schematic diagram showed the mechanism of circ_0014736 regulating human placental trophoblast cell dysfunction in PE.

Abbreviations

Biotin-miR-942-5p

biotin-labeled miR-942-5p

circRNA

circular RNA

EdU

5-Ethynyl-2′-deoxyuridine

GPR4

G protein-coupled receptor 4

PE

preeclampsia

RIP

RNA immunoprecipitation

WT

wild-type

3′-UTR

3′-untranslated region

tel: +86-021-59579914

Acknowledgemt

Not applicable.

  1. Funding information: No funding was received.

  2. Author contributions: All authors made substantial contribution to conception and design, acquisition of the data, or analysis and interpretation of the data; take part in drafting the article or revising it critically for important intellectual content; gave final approval of the revision to be published; and agree to be accountable for all aspect of the work.

  3. Conflict of interest: The authors declare that they have no competing interest.

  4. Data availability statement: The analyzed datasets generated during the present study are available from the corresponding author on reasonable request.

References

[1] Cui Y, Wang W, Dong N, Lou J, Srinivasan DK, Cheng W, et al. Role of corin in trophoblast invasion and uterine spiral artery remodelling in pregnancy. Nature. 2012;484:246–50.10.1038/nature10897Suche in Google Scholar PubMed PubMed Central

[2] Agius A, Sultana R, Camenzuli C, Calleja-Agius J, Balzan R. An update on the genetics of pre-eclampsia. Minerva Ginecol. 2018;70:465–79.10.23736/S0026-4784.17.04150-8Suche in Google Scholar PubMed

[3] Nakashima A, Cheng SB, Kusabiraki T, Motomura K, Aoki A, Ushijima A, et al. Endoplasmic reticulum stress disrupts lysosomal homeostasis and induces blockade of autophagic flux in human trophoblasts. Sci Rep. 2019;9:11466.10.1038/s41598-019-47607-5Suche in Google Scholar PubMed PubMed Central

[4] Fisher SJ. Why is placentation abnormal in preeclampsia? Am J Obstet Gynecol. 2015;213:S115–22.10.1016/j.ajog.2015.08.042Suche in Google Scholar PubMed PubMed Central

[5] Zhu S, Li Z, Cui L, Ban Y, Leung PCK, Li Y, et al. Activin A increases human trophoblast invasion by upregulating integrin β1 through ALK4. FASEB J. 2021;35:e21220.10.1096/fj.202001604RSuche in Google Scholar PubMed

[6] Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science. 2005;308:1592–4.10.1126/science.1111726Suche in Google Scholar PubMed

[7] Chen LL, Yang L. Regulation of circRNA biogenesis. RNA Biol. 2015;12:381–8.10.1080/15476286.2015.1020271Suche in Google Scholar PubMed PubMed Central

[8] Zhang Y, Xue W, Li X, Zhang J, Chen S, Zhang JL, et al. The biogenesis of nascent circular RNAs. Cell Rep. 2016;15:611–24.10.1016/j.celrep.2016.03.058Suche in Google Scholar PubMed

[9] Gao JL, Chen G, He HQ, Wang J. CircRNA as a new field in human disease research. Zhongguo Zhong Yao Za Zhi. 2018;43:457–62.Suche in Google Scholar

[10] Li X, Yang L, Chen LL. The biogenesis, functions, and challenges of circular RNAs. Mol Cell. 2018;71:428–42.10.1016/j.molcel.2018.06.034Suche in Google Scholar PubMed

[11] Jia N, Li J. Role of circular RNAs in preeclampsia. Dis Markers. 2019;2019:7237495.10.1155/2019/7237495Suche in Google Scholar PubMed PubMed Central

[12] Zhou W, Wang H, Wu X, Long W, Zheng F, Kong J, et al. The profile analysis of circular RNAs in human placenta of preeclampsia. Exp Biol Med (Maywood). 2018;243:1109–17.10.1177/1535370218813525Suche in Google Scholar PubMed PubMed Central

[13] Hu X, Ao J, Li X, Zhang H, Wu J, Cheng W. Competing endogenous RNA expression profiling in pre-eclampsia identifies hsa_circ_0036877 as a potential novel blood biomarker for early pre-eclampsia. Clin Epigenetics. 2018;10:48.10.1186/s13148-018-0482-3Suche in Google Scholar PubMed PubMed Central

[14] Bai Y, Rao H, Chen W, Luo X, Tong C, Qi H. Profiles of circular RNAs in human placenta and their potential roles related to preeclampsia. Biol Reprod. 2018;98:705–12.10.1093/biolre/ioy034Suche in Google Scholar PubMed

[15] Krol J, Loedige I, Filipowicz W. The widespread regulation of microRNA biogenesis, function and decay. Nat Rev Genet. 2010;11:597–610.10.1038/nrg2843Suche in Google Scholar PubMed

[16] Zhang H, He Y, Wang JX, Chen MH, Xu JJ, Jiang MH, et al. miR-30-5p-mediated ferroptosis of trophoblasts is implicated in the pathogenesis of preeclampsia. Redox Biol. 2020;29:101402.10.1016/j.redox.2019.101402Suche in Google Scholar PubMed PubMed Central

[17] Shen L, Li Y, Li R, Diao Z, Yany M, Wu M, et al. Placenta-associated serum exosomal miR-155 derived from patients with preeclampsia inhibits eNOS expression in human umbilical vein endothelial cells. Int J Mol Med. 2018;41:1731–9.10.3892/ijmm.2018.3367Suche in Google Scholar PubMed

[18] Enquobahrie DA, Abetew DF, Sorensen TK, Willoughby D, Chidambaram K, Williams MA. Placental microRNA expression in pregnancies complicated by preeclampsia. Am J Obstet Gynecol. 2011;204:178.e112–121.10.1016/j.ajog.2010.09.004Suche in Google Scholar PubMed PubMed Central

[19] Luo S, Cao N, Tang Y, Gu W. Identification of key microRNAs and genes in preeclampsia by bioinformatics analysis. PLoS One. 2017;12:e0178549.10.1371/journal.pone.0178549Suche in Google Scholar PubMed PubMed Central

[20] Li X, Yang R, Xu Y, Zhang Y. Circ_0001438 participates in the pathogenesis of preeclampsia via the circ_0001438/miR-942/NLRP3 regulatory network. Placenta. 2021;104:40–50.10.1016/j.placenta.2020.11.005Suche in Google Scholar PubMed

[21] Qi H, Yao C, Xing J, Qin Y. Hypoxia-induced GPR4 suppresses trophoblast cell migration and proliferation through the MAPK signaling pathway. Reprod Toxicol. 2021;99:1–8.10.1016/j.reprotox.2020.11.001Suche in Google Scholar PubMed

[22] Lisonkova S, Sabr Y, Mayer C, Young C, Skoll A, Joseph KS. Maternal morbidity associated with early-onset and late-onset preeclampsia. Obstet Gynecol. 2014;124:771–81.10.1097/AOG.0000000000000472Suche in Google Scholar PubMed

[23] Chakraborty C, Gleeson LM, McKinnon T, Lala PK. Regulation of human trophoblast migration and invasiveness. Can J Physiol Pharmacol. 2002;80:116–24.10.1139/y02-016Suche in Google Scholar PubMed

[24] Ye Y, Li M, Chen L, Li S, Quan Z. Circ-AK2 is associated with preeclampsia and regulates biological behaviors of trophoblast cells through miR-454-3p/THBS2. Placenta. 2021;103:156–63.10.1016/j.placenta.2020.10.023Suche in Google Scholar PubMed

[25] Shen X-Y, Zheng L-L, Huang J, Kong H-F, Chang Y-J, Wang F, et al. CircTRNC18 inhibits trophoblast cell migration and epithelial–mesenchymal transition by regulating miR-762/Grhl2 pathway in pre-eclampsia. RNA Biol. 2019;16:1565–73.10.1080/15476286.2019.1644591Suche in Google Scholar PubMed PubMed Central

[26] Luo N, Gao HM, Wang YQ, Li HJ, Li Y. MiR-942-5p alleviates septic acute kidney injury by targeting FOXO3. Eur Rev Med Pharmacol Sci. 2020;24:6237–44.Suche in Google Scholar

[27] Zhang W, Mao K, Liu S, Xu Y, Ren J. miR-942-5p promotes the proliferation and invasion of human melanoma cells by targeting DKK3. J Recept Signal Transduct Res. 2021;41:180–7.10.1080/10799893.2020.1804280Suche in Google Scholar PubMed

[28] Du Z, Wang L, Xia Y. circ_0015756 promotes the progression of ovarian cancer by regulating miR-942-5p/CUL4B pathway. Cancer Cell Int. 2020;20:572.10.1186/s12935-020-01666-1Suche in Google Scholar PubMed PubMed Central

[29] Wan H, You T, Luo W. circ_0003204 regulates cell growth, oxidative stress, and inflammation in ox-LDL-induced vascular endothelial cells via regulating miR-942-5p/HDAC9 axis. Front Cardiovasc Med. 2021;8:646832.10.3389/fcvm.2021.646832Suche in Google Scholar PubMed PubMed Central

[30] Coskun S, Karadag M, Gokcen C, Oztuzcu S. miR-132 and miR-942 expression levels in children with attention deficit and hyperactivity disorder: a controlled study. Clin Psychopharmacol Neurosci. 2021;19:262–8.10.9758/cpn.2021.19.2.262Suche in Google Scholar PubMed PubMed Central

[31] Zhang Y, Huang G, Zhang Y, Yang H, Long Y, Liang Q, et al. MiR-942 decreased before 20 weeks gestation in women with preeclampsia and was associated with the pathophysiology of preeclampsia in vitro. Clin Exp Hypertens. 2017;39:108–13.10.1080/10641963.2016.1210619Suche in Google Scholar PubMed

[32] Radu CG, Nijagal A, McLaughlin J, Wang L, Witte ON. Differential proton sensitivity of related G protein-coupled receptors T cell death-associated gene 8 and G2A expressed in immune cells. Proc Natl Acad Sci U S A. 2005;102:1632–7.10.1073/pnas.0409415102Suche in Google Scholar PubMed PubMed Central

[33] Huang F, Mehta D, Predescu S, Kim KS, Lum H. A novel lysophospholipid- and pH-sensitive receptor, GPR4, in brain endothelial cells regulates monocyte transmigration. Endothelium. 2007;14:25–34.10.1080/10623320601177288Suche in Google Scholar PubMed

[34] Okajima F. Regulation of inflammation by extracellular acidification and proton-sensing GPCRs. Cell Signal. 2013;25:2263–71.10.1016/j.cellsig.2013.07.022Suche in Google Scholar PubMed

[35] Yu M, Cui R, Huang Y, Luo Y, Qin S, Zhong M. Increased proton-sensing receptor GPR4 signalling promotes colorectal cancer progression by activating the hippo pathway. EBioMedicine. 2019;48:264–76.10.1016/j.ebiom.2019.09.016Suche in Google Scholar PubMed PubMed Central

[36] Bai Z, Wu Y, Yan Y, Bai S, Kang H, Ma W, et al. Downregulation of GPR4 and TCF7 enhances apoptosis and decreases growth and invasion of ovarian cancer cells. Anticancer Agents Med Chem. 2020;21:1544–50.10.2174/1871520620666201001104928Suche in Google Scholar PubMed

[37] Tao Q, Lloyd B, Lang S, Houston D, Zorn A, Wylie C. A novel G protein-coupled receptor, related to GPR4, is required for assembly of the cortical actin skeleton in early Xenopus embryos. Development. 2005;132:2825–36.10.1242/dev.01866Suche in Google Scholar PubMed

[38] Kim KS, Ren J, Jiang Y, Ebrahem Q, Tipps R, Cristina K, et al. GPR4 plays a critical role in endothelial cell function and mediates the effects of sphingosylphosphorylcholine. FASEB J. 2005;19:819–21.10.1096/fj.04-2988fjeSuche in Google Scholar PubMed

[39] Sun X, Tommasi E, Molina D, Sah R, Brosnihan KB, Diz D, et al. Deletion of proton-sensing receptor GPR4 associates with lower blood pressure and lower binding of angiotensin II receptor in SFO. Am J Physiol Ren Physiol. 2016;311:F1260–6.10.1152/ajprenal.00410.2016Suche in Google Scholar PubMed PubMed Central

[40] Abou-Kheir W, Barrak J, Hadadeh O, Daoud G. HTR-8/SVneo cell line contains a mixed population of cells. Placenta. 2017;50:1–7.10.1016/j.placenta.2016.12.007Suche in Google Scholar PubMed

Received: 2022-08-03
Revised: 2022-11-16
Accepted: 2023-01-02
Published Online: 2023-03-01

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2023-0645
Schlagwörter für diesen Artikel
preeclampsia; circ_0014736; miR-942-5p; GPR4
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 3.10.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0645/html
Button zum nach oben scrollen