Home Umbilical Cord Tissue Derived Mesenchymal Stem Cells Can Differentiate into Skin Cells
Article Open Access

Umbilical Cord Tissue Derived Mesenchymal Stem Cells Can Differentiate into Skin Cells

  • Qandeel Fatima , Nakhshab Choudhry and Mahmood S Choudhery EMAIL logo
Published/Copyright: December 31, 2018
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 13 Issue 1

Abstract

Autologous skin grafts are used to treat severe burn wounds, however, the availability of adequate donor sites makes this option less practical. Recently, stem cells have been used successfully in tissue engineering and in regenerative medicine. The current study aims to differentiate umbilical cord tissue derived mesenchymal stem cells (CT-MSCs) into skin cells (fibroblasts and keratinocytes) for use to treat severe burn wounds. After isolation, MSCs were characterized and their growth characteristics were determined. The cells were induced to differentiate into fibroblasts and keratinocytes using respective induction medium. Results indicated that CT-MSCs were spindle shaped, plastic adherent and positive for CD29, CD44, CD73, CD90 markers. CT-MSCs also showed high proliferative potential as indicated by cumulative population doubling, doubling time and plating efficiency. The MSCs were successfully differentiated into fibroblast and keratinocytes as indicated by morphological changes and expression of lineage specific genes. We propose that these differentiated skin cells which are derived from CT-MSCs can thus be used for the development of bioengineered skin; however, further studies are required to evaluate the utility of these substitutes.

Keywords: mesenchymal stem cells; cord tissue; bioengineered skin; skin cells; keratinocytes; fibroblasts

1 Introduction

Skin wound healing requires restoration of both the dermal and epidermal layers of skin. Normally re-epithelization occurs by proliferation of keratinocytes that migrate from the wound edges. Similarly, fibroblast proliferation and release of growth factors restore dermis. In severe burn injuries, the normal repair process becomes defective. Autologous skin grafts is a treatment for severe burn wounds. However, problems such as the availability of adequate donor sites (for use as a graft) and chances of infection (due to additional injury) make this option less practical [1]. Recently, the use of adult stem cells has become a promising approach for the treatment of several diseases and disorders [2]. These cells are found in different adult and neonatal tissues. Stem cells possess two important characteristics, this is the ability of self-renewal and the ability to differentiate into specific cell types under appropriate culture conditions. Mesenchymal stem cells (MSCs) are a type of adult stem cells that have remarkable differentiation potential and could be utilized for repair and regeneration of lost tissues [3].

The high proliferation, multi-lineage differentiation capacity, immunomodulatory and immunosuppressive properties have made MSCs promising therapeutic candidates [4, 5, 6]. The MSCs can be isolated from adult (such as bone marrow, adipose tissue, synovial membrane, teeth etc.) and neonatal sources (such as cord blood, cord tissue) [7, 8, 9, 10]. The current study has focused on umbilical cord tissue derived MSCs (CT-MSCs) as human cord tissue is readily available. There are certain advantages in using cord tissue, firstly, a large number of MSCs can be harvested and secondly, its isolation poses no risk to donors. Finally, CT-MSCs are less immunogenic and can be expanded extensively in vitro [11, 12].

In the current study, MSCs were isolated from human umbilical cord tissue by an explant culture technique. These cells were characterized and their growth characteristics were determined. CT-MSCs were differentiated into fibroblasts and keratinocytes by culturing in the respective induction medium. Results show that CT-MSCs exhibited spindle shape morphology, plastic adherent growth and expression of CD29, CD44, CD73, CD90 markers. The CT-MSCs exhibited high proliferative potential as indicated by cumulative population doubling and plating efficiency. On the other hand, the differentiated fibroblast and keratinocyte exhibited a changed morphology and had expression of lineage specific genes. We show that CT-MSCs can be differentiated into both types of skin cells (i.e. keratinocytes and fibroblasts) that could be used in the future development of bioengineered skin. However, further studies will be required to evaluate the utility of such substitutes.

2 Material And Methods

2.1 Collection and isolation of cord tissues

Human umbilical cord tissues were collected following full-term cesarean births. Around 3-5 inches of cord tissue was transferred from the hospital to the cell processing facility under sterilized conditions. All samples were obtained after written consent from the donors. All procedures were performed according to the protocol approved by local Institution Review Board at the King Edward Medical University.

CT-MSCs were obtained using the explant culture technique as previously described [13]. Briefly, after washing with PBS (phosphate buffered saline), tissue pieces were minced into small pieces. Complete culture medium (Dulbecco’s Modified Eagle Medium (DMEM) + 1% non-essential amino acids + 1% penicillin/streptomycin solution) supplemented with 10% fetal bovine serum (FBS) was added and minced tissue pieces were incubated in culture flasks at 37°C with 5% CO2 in humid conditions.

Informed consent: Informed consent has been obtained from all individuals included in this study

Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance the tenets of the Helsinki Declaration, and has been approved by Institution Review Board at the King Edward Medical University.

2.1.1 Plating efficiency (PE)

At passage 1, 40 cells/cm2 were plated into a 25cm2 culture flask containing complete medium and incubated at standard culture conditions for 2 weeks. After 2 weeks of culture, the medium was removed and cell colonies were fixed with absolute methanol and stained with 0.1% crystal violet dye. Cell colonies (with more than 30 cells) were counted under phase contrast microscope and PE was measured using the following formula [13]

PE: [Total number of colonies/ number of cells initially plated] x 100

2.1.2 Number and time of population doublings

To determine population doublings, initial cell number and number of cells harvested at each passage was recorded. The following formulae were used to calculate the cumulative population doublings and population doubling time [13]

cPDs=LogN/No×3.33         DT=CT/cPDs

Where, ‘cPDs’ represent cumulative population doublings, ‘No’ is the number of cells plated, ‘N’ is the cells number harvested, ‘CT’ is the time in culture and ‘DT’ is the doubling time.

2.2 Differentiation of CT-MSCs into skin cells

For differentiation, CT-MSCs were cultured in keratinocyte or fibroblast induction medium for 2 weeks. The fibroblast differentiation medium contained DMEM (Gibco, Cat# 11995-065), 10% FBS (Merck, Cat# 2020-07-31), 1% penicillin/streptomycin solution (Capricon, Cat# CP13-1019), 5 ug/ml insulin (Sigma, Cat# 19278-5ml) and 1 ng/ml basic fibroblast growth factor (Sigma, Cat# F02901) while keratinocyte differentiation medium consisted of DMEM, 10% FBS, 1% penicillin/streptomycin solution, 0.5 mg/ml hydrocortisone (Sigma, Cat# H-4001), 1% insulin transferrin (Roche, Cat# 13532600) and 15 ng/ml keratinocytes growth factor (Sigma, Cat# H6666). Differentiation of CT-MSCs into fibroblasts and keratinocytes was confirmed by morphological changes and through polymerase chain reaction (PCR) using marker genes for fibroblast (desmin, collagen 3, vimentin, FGF7) and keratinocytes (CK1, CK10, CK14).

2.3 Reverse transcription polymerase chain reaction (RT-PCR)

Expression of lineage specific genes was carried out by RT-PCR. Briefly, cells were cultured for 15 days in the respective differentiation medium and total RNA was extracted using Trizol. Following extraction, the RNA was quantified using NanoDrop. For cDNA synthesis, 1.5ug of RNA sample was used using Wizscript cDNA synthesis kit. The WizPure™ PCR master mix was used for quantitating the expression level of genes. Sequences for primer pairs and their product lengths (bp) are shown in Table 1. Gel bands were measured with image J software.

Table 1

List of used primers and their sequences.

Genetic Markera5'-3'sequenceProduct size
Beta Act inCGCATGGGTCAGAAGGATTC (F)

TAGAAGGTGTGGTGCCAGATTT (Fi)		137
CD 29GCAGTTGGTTTTGCGATTAAG (F)

AAGGCATCACAGTCTTTTCCA (R)		233
CD 44AGAAAAATGGTCGCTACÄGCA (F)

CT GAAGTGCTGCTCCTTTCAC (R )		571
CD 45CACTGCAGGGATGGATCTCA (F)

ACTCGTGGGTTCAGAACCTTCA (R)		312
CD 73ACAACAGCCAACTGCTTTCAT (F)

TTCTCAGCATTCCCGAAAT [R)		154
CD 90ATGAACCTGGCCATCAGCATGC (F )

CACGAGGTGTTCTGAGCCAGCA (R)		344
CK1GGAGGAGGAGGTGGTAGATTTT (F)

GAGGTTGCTGATGTATGACTCG (R)		388
CK1DGAGCAAGGAACTGACTACAG (F)

CTCGGTTTCAGCTGCAATCT (R)		249
CK14TGCTATTGGTGTCÄGGGAAG (F)

GTGGCAAGGTTCTTTTCTCC ( R )		277
Collagen-3GTTGACCCTAACCAAGGATGCA (F)

GGAAGTTCAGGATTGCCGTAG (R)		203
VimentinCTGCGGGAGTAGTTGGAAAGT ( F)

GGAAATGGGACAAAACATCCT (R)		241
FGF7TGGTGAAGTTCATGGATGT CTATC (F)

CACAGGATGGCTTGAAGATGTA (R)		212
DesminCATCCTCAAGAAGGTGTTGGAG (F)

CAAAGAGACGTGGGACGAGT (R)		112
4-0ctGGCGTTCTCTTTGGAAAGGTGTTC (F)

CTCGAACCACATCCTTCTCT (R)		145
SSEA4CCGCGTCAAGAGGCCCATGAA (F)

CCCGCTTCTCGGTCTCGGACAA (R)		148

2.4 Data Analysis Procedure

Statistical analysis of data was performed using GraphPad Prism version 6. The data was expressed as mean ± standard deviation. All experiments were performed on at least three samples in triplicate.

3 Results

3.1 Isolation and characterization of MSCs

We used an explant culture technique to obtain pure MSC population (Figure 1A). Within 7 days, MSCs appeared around the small pieces of cord tissue (Figure 1B). Cells grew rapidly around the tissue pieces (Figure 1C) and become confluent within two weeks (Figure 1D). CT-MSCs exhibited plastic adherent growth and spindle shaped morphology (Figure 1E). This spindle shaped morphology

Figure 1 Isolation and characterization of CT-MSCs: MSCs from cord tissue pieces were isolated using explant tissue culture (A). MSCs started to grow out of small cord tissue pieces within a week (B). Cells around cord tissue pieces after 10 days of culturing (C). Cells after 2 weeks of culture (D). CT-MSCs showed homogeneous spindle shaped morphology (E).CT-MSCs maintained their spindle shped morphology during passaging. The cells shown here are at passage 7 (F). PCR analysis showed positive expression of CD29, CD 44, CD73 and CD90, and negative expression of CD45 in CT-MSCs (G).
Figure 1

Isolation and characterization of CT-MSCs: MSCs from cord tissue pieces were isolated using explant tissue culture (A). MSCs started to grow out of small cord tissue pieces within a week (B). Cells around cord tissue pieces after 10 days of culturing (C). Cells after 2 weeks of culture (D). CT-MSCs showed homogeneous spindle shaped morphology (E).CT-MSCs maintained their spindle shped morphology during passaging. The cells shown here are at passage 7 (F). PCR analysis showed positive expression of CD29, CD 44, CD73 and CD90, and negative expression of CD45 in CT-MSCs (G).

was maintained even in late passages (Figure 1F). In addition, CT-MSCs were positive for the expression of mesenchymal lineage markers CD29, CD44, CD73, CD90 while being negative for CD45 as determined by RT-PCR (Figure 1G).

3.2 Growth Characteristics

The growth characteristics of CT-MSCs were assessed by measuring plating efficiency, cumulative population doublings, and doubling time. Plating efficiency of

CT-MSCs was evaluated by culturing the cells at low numbers for the eventual growth into colonies. The number of colonies were counted after 2 weeks and this number was used to determine plating efficiency which was 4.225±1.7 (Figure 2).

Figure 2 Plating efficiency of CT-MSCs. Inset shows a single colony of MSCs at high power (10X).
Figure 2

Plating efficiency of CT-MSCs. Inset shows a single colony of MSCs at high power (10X).

To determine the number and time of population doublings at each passage, cells were counted with a hemocytometer and 10% cells were seeded into new culture flasks. The number of cumulative population doublings was 24.67±0.445 for CT-MSCs. Similarly, the average population doubling time for CT-MSCs was 51±3 hours.

3.3 CT-MSCs can differentiate into keratinocytes and fibroblasts

CT-MSCs at passage 2 (n=5) were differentiated into skin cells, either fibroblasts or keratinocytes. For differentiation into fibroblasts and keratinocytes, respective differentiation medium was used for 2 weeks. To serve as a control, cells were cultured in parallel in regular expansion medium.

Compared to the spindle shaped morphology of control group (Figure 3A), MSCs in the keratinocyte differentiated medium showed polygonal shape (Figure 3B). Similarly, RT-PCR results indicated that differentiated MSCs were positive for keratinocyte lineage markers (CK1, CK10, CK14) at day 7 and day 14 (Figure 3C, D). In contrast, the expression of OCT4 and SSEA4 stem cell markers was downregulated (Figure 3E, F).

Figure 3 In vitro differentiation of CT-MSCs into keratinocytes: Untreated CT-MSCs exhibit spindle shape morphology (A). MSCs induced into keratinocytes exhibits a polygonal shape (B). Results of RT-PCR show that differentiated cells were positive for keratinocyte specific genes CK1, CK10 and CK14 (C). Quantification of gel bands using ImageJ software (D). Expression of SSEA4 and OCT4 decreased during differentiation into keratinocytes (E, F).
Figure 3

In vitro differentiation of CT-MSCs into keratinocytes: Untreated CT-MSCs exhibit spindle shape morphology (A). MSCs induced into keratinocytes exhibits a polygonal shape (B). Results of RT-PCR show that differentiated cells were positive for keratinocyte specific genes CK1, CK10 and CK14 (C). Quantification of gel bands using ImageJ software (D). Expression of SSEA4 and OCT4 decreased during differentiation into keratinocytes (E, F).

Differentiation of CT-MSCs into fibroblasts was terminated after 14 days. Untreated CT-MSCs at 7 and 14 days were used as controls and showed no morphological changes (Figure 4A). This is compared to the prominent morphological changes when cultured in fibroblast induction medium (Figure 4B). The morphology of CT-MSCs cultured in fibroblast induction medium changed considerably from spindle shape to a more elongated shape (Figure 4B). Furthermore, the expression of collagen-3, desmin, FGF-7, and vimentin was up-regulated after 14 days (Figure 4C, D) while the expression of SSEA4 and OCT4 was down-regulated (Figure 4E, F).

Figure 4 In vitro differentiation of CT-MSCs into Fibroblasts. Untreated CT-MSC exhibit spindle shape morphology (A). Treated CT- MSCs exhibited more elongated spindles morphology after culturing in fibroblast differentiation medium (B). Results of RT-PCR indicate that differentiated cells were positive for fibroblast specific genes (collagen-3, vimentin, FGF-7, desmin). RT-PCR analysis also showed upregulated expression of fibroblast specific markers, collagen-3, vimentin, FGF-7, and desmin after 14 days of differentiation versus 7 days (C). Quantification of gel bands with ImageJ software (D). Expression of stem cell markers was downregulated at 14 days of culture in fibroblast differentiation media versus 7 days culture
Figure 4

In vitro differentiation of CT-MSCs into Fibroblasts. Untreated CT-MSC exhibit spindle shape morphology (A). Treated CT- MSCs exhibited more elongated spindles morphology after culturing in fibroblast differentiation medium (B). Results of RT-PCR indicate that differentiated cells were positive for fibroblast specific genes (collagen-3, vimentin, FGF-7, desmin). RT-PCR analysis also showed upregulated expression of fibroblast specific markers, collagen-3, vimentin, FGF-7, and desmin after 14 days of differentiation versus 7 days (C). Quantification of gel bands with ImageJ software (D). Expression of stem cell markers was downregulated at 14 days of culture in fibroblast differentiation media versus 7 days culture

4 Discussion

Rapid repair and management of large skin ruptures is often necessary for the survival of patients. Minor wounds may heal without intervention, however, severe skin injuries require additional care. For severe burn injuries, autologous skin grafting is the best option available. However, there are certain limitations that make this treatment option less practical [14, 15]. In the current study, CT-MSCs were differentiated into keratinocytes and fibroblasts with the future goal of using these to construct skin constructs. In the previous studies the MSCs isolated from different parts of placenta were either differentiated into fibroblasts or keratinocytes [16, 18]. However, the current study is novel in that MSCs are isolated from umbilical cord tissue and we demonstrate successful differentiation into both types of skin cells (fibroblasts and keratinocytes). The isolation and subsequent differentiation of same cells into both types of cells is more convenient for the reconstruction of artificial skin substitutes. A caveat of our study is that we have not evaluated the utility of these differentiated skin cells in vitro or in vivo.

MSCs from the umbilical cord tissue were isolated by the explant culture method. This method is inexpensive and provided pure MSC population [13, 16]. We observed cell outgrowth within a week after the initial culture. Following 2-3 weeks of culture, a sufficient number of cells was obtained, which allowed for further experiments. The MSCs from tissue pieces exhibited plastic adherent growth, spindle shaped morphology and positive expression of MSCs genes (CD29, CD44, CD73 CD90) and no expression of CD45 (a hematopoietic marker). These results were similar to already published reports [4, 10, 19, 20, 21, 22, 23]. CT-MSCs showed high proliferative potential as determined by plating efficiency and number of population doublings. The clonogenic potential of CT-MSCs was determined by plating efficiency amd was 4.225±1.7. This was also similar to previous studies in the literature [24, 27]. The number population doublings of CT-MSCs was 24.67±0.445 and their doubling time was 51±3 hours. Similar results were reported by Choudhery and colleagues [13], and Mahmoud et al. [16].

To differentiate CT-MSCs into skin cells (fibroblasts and keratinocytes), they were cultured in respective differentiation medium for 2 weeks. In keratinocyte induction medium, differentiated CT-MSCs exhibited polygonal morphology which was similar to keratinocytes [28]. The differentiated cells were positive for the expression of CK1, CK10 and CK14 markers. Previous studies have demonstrated that keratinocytes express these markers [29, 30]. The CT-MSCs which were differentiated into fibroblasts with fibroblast differentiation medium, became more elongated when compared to the control. Furthermore, these induced cells were positive for collagen-3, desmin, FSP-1 7 and vimentin which are fibroblast specific markers [31, 32, 33]. We also showed that during differentiation into skin cells (fibroblasts and keratinocytes), MSCs exhibited a progressive down regulation of pluripotency markers SSEA4 and OCT4 [34, 35]. In this study we demonstrate that MSCs with standard characteristics can be isolated from human placenta using the explant culture technique. These CT-MSCs can then be induced in vitro to differentiate into skin cells such as fibroblasts and keratinocytes. This successful differentiation was characterized by morphological changes and changes in gene expression profile. We propose that these cells may be used in the future to prepare an artificial skin substitute for use as a treatment for severe burn injuries.

Acknowledgments

We are thankful to the staff of the Lady Aichisen Hospital for providing cord tissue and cord blood samples. This work was supported by a grant from the King Edward Medical University, Lahore, Pakistan.

  1. Conflict of interest: Authors state no conflict of interest

Abbreviations

MSCs

Mesenchymal Stem Cells

CT-MSCs

Cord tissue derived Mesenchymal Stem Cells

KGF

Keratinocyte growth factor

FGF

Fibroblast growth factor

PBS

Phosphate buffer saline

DMEM

Dulbecco’s modified eagle medium

PE

Plating efficiency

cPDs

Cumulative population doublings

DT

Doubling time

References

[1] Saaiq M, Zaib S, Ahmad S. Early excision and grafting versus delayed excision and grafting of deep thermal burns up to 40% total body surface area: a comparison of outcome. Annals of burns and fire disasters. 2012;25(3):143.Search in Google Scholar

[2] Butler KL, Goverman J, Ma H, Fischman A, Yu YM, Bilodeau M, et al. Stem cells and burns: review and therapeutic implications. Journal of Burn Care & Research. 2010;31(6):874-81.10.1097/BCR.0b013e3181f9353aSearch in Google Scholar PubMed

[3] Birenboim R, Markus A, Goldstein RS. Simple generation of neurons from human embryonic stem cells using agarose multiwell dishes. Journal of neuroscience methods. 2013;14(1):9-14.10.1016/j.jneumeth.2012.12.026Search in Google Scholar PubMed

[4] Nombela-Arrieta C, Ritz J, Silberstein LE. The elusive nature and function of mesenchymal stem cells. Nature reviews Molecular cell biology. 2011;12(2):126-31.10.1038/nrm3049Search in Google Scholar PubMed PubMed Central

[5] Jacobs SA, Roobrouck VD, Verfaillie CM, Van Gool SW. Immunological characteristics of human mesenchymal stem cells and multipotent adult progenitor cells. Immunology and cell biology. 2013;91(1):32-9.10.1038/icb.2012.64Search in Google Scholar PubMed PubMed Central

[6] Caplan AI. Why are MSCs therapeutic? New data: new insight. The Journal of pathology. 2009;217(2):318-24.10.1002/path.2469Search in Google Scholar PubMed PubMed Central

[7] Rebelatto CK, Aguiar AM, Moretao MP, Senegaglia AC, Hansen P, Barchiki F, et al. Dissimilar differentiation of mesenchymal stem cells from bone marrow, umbilical cord blood, and adipose tissue. Experimental Biology and Medicine. 2008;233(7):901-13.10.3181/0712-RM-356Search in Google Scholar PubMed

[8] Bianco P, Robey PG, Simmons PJ. Mesenchymal stem cells: revisiting history, concepts, and assays. Cell stem cell. 2008;2(4):313-9.10.1016/j.stem.2008.03.002Search in Google Scholar PubMed PubMed Central

[9] Si YL, Zhao YL, Hao HJ, Fu XB, Han WD. MSCs: biological characteristics, clinical applications and their outstanding concerns. Ageing research reviews. 2011;10(1):93-103.10.1016/j.arr.2010.08.005Search in Google Scholar PubMed

[10] Lu LL, Liu YJ, Yang SG, Zhao QJ, Wang X, Gong W, et al. Isolation and characterization of human umbilical cord mesenchymal stem cells with hematopoiesis-supportive function and other potentials. haematologica. 2006;91(8):1017-26.Search in Google Scholar

[11] Weiss ML, Troyer DL. Stem cells in the umbilical cord. Stem Cell Reviews and Reports. 2006;2(2):155-62.10.1007/s12015-006-0022-ySearch in Google Scholar PubMed PubMed Central

[12] Bongso A, Fong CY. The therapeutic potential, challenges and future clinical directions of stem cells from the Wharton’s jelly of the human umbilical cord. Stem Cell Reviews and Reports. 2013;9(2):226-40.10.1007/s12015-012-9418-zSearch in Google Scholar PubMed

[13] Choudhery MS, Badowski M, Muise A, Harris DT. Comparison of human mesenchymal stem cells derived from adipose and cord tissue. Cytotherapy. 2013;15(3):330-43.10.1016/j.jcyt.2012.11.010Search in Google Scholar

[14] Li L, Xie T. Stem cell niche: structure and function. Annu. Rev. Cell Dev. Biol. 2005 Nov 10;21:605-31.10.1146/annurev.cellbio.21.012704.131525Search in Google Scholar

[15] Lorenti A. Wound healing: from epidermis culture to tissue engineering. CellBio. 2012;1(02):17.10.4236/cellbio.2012.12003Search in Google Scholar

[16] Mahmood R, Choudhery MS, Mehmood A, Khan SN, Riazuddin S. In vitro differentiation potential of human placenta derived cells into skin cells. Stem cells international. 2015;2015.10.1155/2015/841062Search in Google Scholar

[17] Lee CH, Moioli EK, Mao JJ. Fibroblastic differentiation of human mesenchymal stem cells using connective tissue growth factor. InEngineering in Medicine and Biology Society, 2006. EMBS'06. 28th Annual International Conference of the IEEE 2006 Aug 30 (pp. 775-778). IEEE.10.1109/IEMBS.2006.259866Search in Google Scholar

[18] El Ansary MA, Shaheen N, Farid R, Bishai IE. Mesenchymal Stem Cell Separation From Wharton's Jelly And Its Transdifferentiation Into Keratinocytes. Vox Sanguinis. 2012;103:253.Search in Google Scholar

[19] Seshareddy K, Troyer D, Weiss ML. Method to isolate mesenchymal‐like cells from Wharton's Jelly of umbilical cord. Methods in cell biology. 2008;86:101-19.10.1016/S0091-679X(08)00006-XSearch in Google Scholar

[20] Jo CH, Kim OS, Park EY, Kim BJ, Lee JH, Kang SB, et al. Fetal mesenchymal stem cells derived from human umbilical cord sustain primitive characteristics during extensive expansion. Cell and tissue research. 2008;334(3):423-33.10.1007/s00441-008-0696-3Search in Google Scholar PubMed

[21] Wegmeyer H, Bröske AM, Leddin M, Kuentzer K, Nisslbeck AK, Hupfeld J, et al. Mesenchymal stromal cell characteristics vary depending on their origin. Stem cells and development. 2013;22(19):2606-18.10.1089/scd.2013.0016Search in Google Scholar PubMed PubMed Central

[22] Dominici ML, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini FC, Krause DS, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006;8(4):315-7.10.1080/14653240600855905Search in Google Scholar PubMed

[23] Zhang L, Chan C. Isolation and enrichment of rat mesenchymal stem cells (MSCs) and separation of single-colony derived MSCs. Journal of visualized experiments: JoVE. 2010(37).10.3791/1852Search in Google Scholar PubMed PubMed Central

[24] Kern S, Eichler H, Stoeve J, Klüter H, Bieback K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem cells. 2006;24(5):1294-301.10.1634/stemcells.2005-0342Search in Google Scholar PubMed

[25] Shetty P, Cooper K, Viswanathan C. Comparison of proliferative and multilineage differentiation potentials of cord matrix, cord blood, and bone marrow mesenchymal stem cells. Asian Journal of Transfusion Science. 2010;4(1):14.10.4103/0973-6247.59386Search in Google Scholar PubMed PubMed Central

[26] Jin HJ, Bae YK, Kim M, Kwon SJ, Jeon HB, Choi SJ, et al. Comparative analysis of human mesenchymal stem cells from bone marrow, adipose tissue, and umbilical cord blood as sources of cell therapy. International journal of molecular sciences. 2013;14(9):17986-8001.10.3390/ijms140917986Search in Google Scholar PubMed PubMed Central

[27] Corradetti B, Lange‐Consiglio A, Barucca M, Cremonesi F, Bizzaro D. Size‐sieved subpopulations of mesenchymal stem cells from intervascular and perivascular equine umbilical cord matrix. Cell proliferation. 2011;44(4):330-42.10.1111/j.1365-2184.2011.00759.xSearch in Google Scholar PubMed PubMed Central

[28] Fatimah SS, Tan GC, Chua K, Tan AE, Azurah AG, Hayati AR. Effects of keratinocyte growth factor on skin epithelial differentiation of human amnion epithelial cells. Burns. 2013;39(5):905-15.10.1016/j.burns.2012.10.019Search in Google Scholar PubMed

[29] Laplante AF, Germain L, Auger FA, Moulin V. Mechanisms of wound reepithelialization: hints from a tissue-engineered reconstructed skin to long-standing questions. The FASEB Journal. 2001;15(13):2377-89.10.1096/fj.01-0250comSearch in Google Scholar PubMed

[30] Sun HY, Zhou GM, Wang Q, Lin XC, Xu B. In vitro culture system for keratinocytes obtained from oral lichen planus lesions. Clinical oral investigations. 2014;18(4):1195-203.10.1007/s00784-013-1083-3Search in Google Scholar PubMed

[31] Yamada N, Uchinuma E, Kuroyanagi Y. Clinical trial of allogeneic cultured dermal substitutes for intractable skin ulcers of the lower leg. Journal of Artificial Organs. 2008;11(2):100-3.10.1007/s10047-008-0406-7Search in Google Scholar PubMed

[32] Dienus K, Bayat A, Gilmore BF, Seifert O. Increased expression of fibroblast activation protein-alpha in keloid fibroblasts: implications for development of a novel treatment option. Archives of dermatological research. 2010;302(10):725-31.10.1007/s00403-010-1084-xSearch in Google Scholar PubMed

[33] Han Y, Chai J, Sun T, Li D, Tao R. Differentiation of human umbilical cord mesenchymal stem cells into dermal fibroblasts in vitro. Biochemical and biophysical research communications. 2011;413(4):561-5.10.1016/j.bbrc.2011.09.001Search in Google Scholar PubMed

[34] Green H, Easley K, Iuchi S. Marker succession during the development of keratinocytes from cultured human embryonic stem cells. Proceedings of the National Academy of Sciences. 2003;100(26):15625-30.10.1073/pnas.0307226100Search in Google Scholar PubMed PubMed Central

[35] Noisa P, Ramasamy TS, Lamont FR, Jason SL, Sheldon MJ, Russell A, Jin X, Cui W. Identification and characterisation of the early differentiating cells in neural differentiation of human embryonic stem cells. PLoS One. 2012;7(5):e37129.10.1371/journal.pone.0037129Search in Google Scholar PubMed PubMed Central

Received: 2018-09-08
Accepted: 2018-10-31
Published Online: 2018-12-31

© 2018 Qandeel Fatima et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Articles in the same Issue

  1. Research Article
  2. Purification of Tea saponins and Evaluation of its Effect on Alcohol Dehydrogenase Activity
  3. Runt-related transcription factor 3 promoter hypermethylation and gastric cancer risk: A meta-analysis
  4. Risk Factors for Venous Thromboembolism in Hospitalized Patients in the Chinese Population
  5. Value of Dual-energy Lung Perfusion Imaging Using a Dual-source CT System for the Pulmonary Embolism
  6. A new combination of substrates: biogas production and diversity of the methanogenic microorganisms
  7. mTOR modulates CD8+ T cell differentiation in mice with invasive pulmonary aspergillosis
  8. Direct Effects on Seed Germination of 17 Tree Species under Elevated Temperature and CO2 Conditions
  9. Role of water soluble vitamins in the reduction diet of an amateur sportsman
  10. Aberrant DNA methylation involved in obese women with systemic insulin resistance
  11. 16S ribosomal RNA-based gut microbiome composition analysis in infants with breast milk jaundice
  12. Characterization of Haemophilus parasuis Serovar 2 CL120103, a Moderately Virulent Strain in China
  13. MiRNA-145 induces apoptosis in a gallbladder carcinoma cell line by targeting DFF45
  14. Telmisartan induces osteosarcoma cells growth inhibition and apoptosis via suppressing mTOR pathway
  15. Optimizing the Formulation for Ginkgolide B Solid Dispersion
  16. Determination of the In Vitro Gas Production and Potential Feed Value of Olive, Mulberry and Sour Orange Tree Leaves
  17. Factors Influencing the Successful Isolation and Expansion of Aging Human Mesenchymal Stem Cells
  18. The Value of Diffusion-Weighted Magnetic Resonance Imaging in Predicting the Efficacy of Radiation and Chemotherapy in Cervical Cancer
  19. Chemical profile and antioxidant activity of Trollius europaeus under the influence of feeding aphids
  20. SSR Markers Suitable for Marker Assisted Selection in Sunflower for Downy Mildew Resistance
  21. A Fibroblast Growth Factor Antagonist Peptide Inhibits Breast Cancer in BALB/c Mice
  22. Antihyperglycemic and antihyperlipidemic effects of low-molecular-weight carrageenan in rats
  23. Microbial indicators and environmental relationships in the Umhlangane River, Durban, South Africa
  24. TUFT1 promotes osteosarcoma cell proliferation and predicts poor prognosis in osteosarcoma patients
  25. Long non-coding RNA-2271 promotes osteogenic differentiation in human bone marrow stem cells
  26. The prediction of cardiac events in patients with acute ST segment elevation myocardial infarction: A meta–analysis of serum uric acid
  27. Risk expansion of Cr through amphibious clonal plant from polluted aquatic to terrestrial habitats
  28. Overexpression of Zinc Finger Transcription Factor ZAT6 Enhances Salt Tolerance
  29. Sini decoction intervention on atherosclerosis via PPARγ-LXRα-ABCA1 pathway in rabbits
  30. Soluble myeloid triggering receptor expressed on myeloid cell 1 might have more diagnostic value for bacterial ascites than C-reactive protein
  31. A Preliminary Study on the Newly Isolated High Laccase-producing Fungi: Screening, Strain Characteristics and Induction of Laccase Production
  32. Hydrolytic Enzyme Production by Thermophilic Bacteria Isolated from Saudi Hot Springs
  33. Analysis of physiological parameters of Desulfovibrio strains from individuals with colitis
  34. Emodin promotes apoptosis of human endometrial cancer through regulating the MAPK and PI3K/ AKT pathways
  35. Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer
  36. Inhibitory activities of ethanolic extracts of two macrofungi against eggs and miracidia of Fasciola spp.
  37. PAQR6 expression enhancement suggests a worse prognosis in prostate cancer patients
  38. Characterization of a potential ripening regulator, SlNAC3, from Solanum lycopersicum
  39. Expression of Angiopoietin and VEGF in cervical cancer and its clinical significance
  40. Umbilical Cord Tissue Derived Mesenchymal Stem Cells Can Differentiate into Skin Cells
  41. Isolation and Characterization of a Phage to Control Vancomycin Resistant Enterococcus faecium
  42. Glycogen Phosphorylase Isoenzyme Bb, Myoglobin and BNP in ANT-Induced Cardiotoxicity
  43. BAG2 overexpression correlates with growth and poor prognosis of esophageal squamous cell carcinoma
  44. Relationship between climate trends and grassland yield across contrasting European locations
  45. Review Articles
  46. Mechanisms of salt tolerance in halophytes: current understanding and recent advances
  47. Salivary protein roles in oral health and as predictors of caries risk
  48. Nanoparticles as carriers of proteins, peptides and other therapeutic molecules
  49. Survival mechanisms to selective pressures and implications
  50. Up-regulation of key glycolysis proteins in cancer development
  51. Communications
  52. In vitro plant regeneration of Zenia insignis Chun
  53. DNA barcoding of online herbal supplements: crowd-sourcing pharmacovigilance in high school
  54. Case Reports
  55. Management of myasthenia gravis during pregnancy: A report of eight cases
  56. Three Cases of Extranodal Rosai-Dorfman Disease and Literature Review
  57. Letters to the Editor
  58. First report of Chlamydia psittaci seroprevalence in black-headed gulls (Larus ridibundus) at Dianchi Lake, China
  59. Special Issue on Agricultural and Biological Sciences - Part II
  60. Chemical composition of essential oil in Mosla chinensis Maxim cv. Jiangxiangru and its inhibitory effect on Staphylococcus aureus biofilm formation
  61. Secondary metabolites of Antarctic fungi antagonistic to aquatic pathogenic bacteria
  62. Study of Seizure-Manifested Hartnup Disorder Case Induced by Novel Mutations in SLC6A19
  63. Transcriptome analysis of Pinus massoniana Lamb. microstrobili during sexual reversal
  64. Mechanism of oxymatrine-induced human esophageal cancer cell apoptosis by the endoplasmic reticulum stress pathway
  65. Methylation pattern polymorphism of cyp19a in Nile tilapia and hybrids
  66. A Method of Biomedical Information Classification based on Particle Swarm Optimization with Inertia Weight and Mutation
  67. A novel TNNI3 gene mutation (c.235C>T/ p.Arg79Cys) found in a thirty-eight-year-old women with hypertrophic cardiomyopathy
  68. Remote Sensing-Based Extraction and Analysis of Temporal and Spatial Variations of Winter Wheat Planting Areas in the Henan Province of China
  69. Topical Issue on Precision Medicine
  70. Serum sTREM-1, PCT, CRP, Lac as biomarkers for death risk within 28 days in patients with severe sepsis
  71. IL-17 gene rs3748067 C>T polymorphism and gastric cancer risk: A meta-analysis
  72. Efficacy of Danhong injection on serum concentration of TNF-α, IL-6 and NF-κB in rats with intracerebral hemorrhage
  73. An ensemble method to predict target genes and pathways in uveal melanoma
  74. Evaluation of the quality of CT images acquired with smart metal artifact reduction software
  75. NPM1A in plasma is a potential prognostic biomarker in acute myeloid leukemia
  76. Arterial infusion of rapamycin in the treatment of rabbit hepatocellular carcinoma to improve the effect of TACE
  77. New progress in understanding the cellular mechanisms of anti-arrhythmic drugs
https://doi.org/10.1515/biol-2018-0065
Keywords for this article
mesenchymal stem cells; cord tissue; bioengineered skin; skin cells; keratinocytes; fibroblasts
Creative Commons
BY-NC-ND 4.0

Articles in the same Issue

  1. Research Article
  2. Purification of Tea saponins and Evaluation of its Effect on Alcohol Dehydrogenase Activity
  3. Runt-related transcription factor 3 promoter hypermethylation and gastric cancer risk: A meta-analysis
  4. Risk Factors for Venous Thromboembolism in Hospitalized Patients in the Chinese Population
  5. Value of Dual-energy Lung Perfusion Imaging Using a Dual-source CT System for the Pulmonary Embolism
  6. A new combination of substrates: biogas production and diversity of the methanogenic microorganisms
  7. mTOR modulates CD8+ T cell differentiation in mice with invasive pulmonary aspergillosis
  8. Direct Effects on Seed Germination of 17 Tree Species under Elevated Temperature and CO2 Conditions
  9. Role of water soluble vitamins in the reduction diet of an amateur sportsman
  10. Aberrant DNA methylation involved in obese women with systemic insulin resistance
  11. 16S ribosomal RNA-based gut microbiome composition analysis in infants with breast milk jaundice
  12. Characterization of Haemophilus parasuis Serovar 2 CL120103, a Moderately Virulent Strain in China
  13. MiRNA-145 induces apoptosis in a gallbladder carcinoma cell line by targeting DFF45
  14. Telmisartan induces osteosarcoma cells growth inhibition and apoptosis via suppressing mTOR pathway
  15. Optimizing the Formulation for Ginkgolide B Solid Dispersion
  16. Determination of the In Vitro Gas Production and Potential Feed Value of Olive, Mulberry and Sour Orange Tree Leaves
  17. Factors Influencing the Successful Isolation and Expansion of Aging Human Mesenchymal Stem Cells
  18. The Value of Diffusion-Weighted Magnetic Resonance Imaging in Predicting the Efficacy of Radiation and Chemotherapy in Cervical Cancer
  19. Chemical profile and antioxidant activity of Trollius europaeus under the influence of feeding aphids
  20. SSR Markers Suitable for Marker Assisted Selection in Sunflower for Downy Mildew Resistance
  21. A Fibroblast Growth Factor Antagonist Peptide Inhibits Breast Cancer in BALB/c Mice
  22. Antihyperglycemic and antihyperlipidemic effects of low-molecular-weight carrageenan in rats
  23. Microbial indicators and environmental relationships in the Umhlangane River, Durban, South Africa
  24. TUFT1 promotes osteosarcoma cell proliferation and predicts poor prognosis in osteosarcoma patients
  25. Long non-coding RNA-2271 promotes osteogenic differentiation in human bone marrow stem cells
  26. The prediction of cardiac events in patients with acute ST segment elevation myocardial infarction: A meta–analysis of serum uric acid
  27. Risk expansion of Cr through amphibious clonal plant from polluted aquatic to terrestrial habitats
  28. Overexpression of Zinc Finger Transcription Factor ZAT6 Enhances Salt Tolerance
  29. Sini decoction intervention on atherosclerosis via PPARγ-LXRα-ABCA1 pathway in rabbits
  30. Soluble myeloid triggering receptor expressed on myeloid cell 1 might have more diagnostic value for bacterial ascites than C-reactive protein
  31. A Preliminary Study on the Newly Isolated High Laccase-producing Fungi: Screening, Strain Characteristics and Induction of Laccase Production
  32. Hydrolytic Enzyme Production by Thermophilic Bacteria Isolated from Saudi Hot Springs
  33. Analysis of physiological parameters of Desulfovibrio strains from individuals with colitis
  34. Emodin promotes apoptosis of human endometrial cancer through regulating the MAPK and PI3K/ AKT pathways
  35. Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer
  36. Inhibitory activities of ethanolic extracts of two macrofungi against eggs and miracidia of Fasciola spp.
  37. PAQR6 expression enhancement suggests a worse prognosis in prostate cancer patients
  38. Characterization of a potential ripening regulator, SlNAC3, from Solanum lycopersicum
  39. Expression of Angiopoietin and VEGF in cervical cancer and its clinical significance
  40. Umbilical Cord Tissue Derived Mesenchymal Stem Cells Can Differentiate into Skin Cells
  41. Isolation and Characterization of a Phage to Control Vancomycin Resistant Enterococcus faecium
  42. Glycogen Phosphorylase Isoenzyme Bb, Myoglobin and BNP in ANT-Induced Cardiotoxicity
  43. BAG2 overexpression correlates with growth and poor prognosis of esophageal squamous cell carcinoma
  44. Relationship between climate trends and grassland yield across contrasting European locations
  45. Review Articles
  46. Mechanisms of salt tolerance in halophytes: current understanding and recent advances
  47. Salivary protein roles in oral health and as predictors of caries risk
  48. Nanoparticles as carriers of proteins, peptides and other therapeutic molecules
  49. Survival mechanisms to selective pressures and implications
  50. Up-regulation of key glycolysis proteins in cancer development
  51. Communications
  52. In vitro plant regeneration of Zenia insignis Chun
  53. DNA barcoding of online herbal supplements: crowd-sourcing pharmacovigilance in high school
  54. Case Reports
  55. Management of myasthenia gravis during pregnancy: A report of eight cases
  56. Three Cases of Extranodal Rosai-Dorfman Disease and Literature Review
  57. Letters to the Editor
  58. First report of Chlamydia psittaci seroprevalence in black-headed gulls (Larus ridibundus) at Dianchi Lake, China
  59. Special Issue on Agricultural and Biological Sciences - Part II
  60. Chemical composition of essential oil in Mosla chinensis Maxim cv. Jiangxiangru and its inhibitory effect on Staphylococcus aureus biofilm formation
  61. Secondary metabolites of Antarctic fungi antagonistic to aquatic pathogenic bacteria
  62. Study of Seizure-Manifested Hartnup Disorder Case Induced by Novel Mutations in SLC6A19
  63. Transcriptome analysis of Pinus massoniana Lamb. microstrobili during sexual reversal
  64. Mechanism of oxymatrine-induced human esophageal cancer cell apoptosis by the endoplasmic reticulum stress pathway
  65. Methylation pattern polymorphism of cyp19a in Nile tilapia and hybrids
  66. A Method of Biomedical Information Classification based on Particle Swarm Optimization with Inertia Weight and Mutation
  67. A novel TNNI3 gene mutation (c.235C>T/ p.Arg79Cys) found in a thirty-eight-year-old women with hypertrophic cardiomyopathy
  68. Remote Sensing-Based Extraction and Analysis of Temporal and Spatial Variations of Winter Wheat Planting Areas in the Henan Province of China
  69. Topical Issue on Precision Medicine
  70. Serum sTREM-1, PCT, CRP, Lac as biomarkers for death risk within 28 days in patients with severe sepsis
  71. IL-17 gene rs3748067 C>T polymorphism and gastric cancer risk: A meta-analysis
  72. Efficacy of Danhong injection on serum concentration of TNF-α, IL-6 and NF-κB in rats with intracerebral hemorrhage
  73. An ensemble method to predict target genes and pathways in uveal melanoma
  74. Evaluation of the quality of CT images acquired with smart metal artifact reduction software
  75. NPM1A in plasma is a potential prognostic biomarker in acute myeloid leukemia
  76. Arterial infusion of rapamycin in the treatment of rabbit hepatocellular carcinoma to improve the effect of TACE
  77. New progress in understanding the cellular mechanisms of anti-arrhythmic drugs
Stay updated on our offers and services
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 23.6.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2018-0065/html
Scroll to top button